EMAIL THIS PAGE TO A FRIEND

TMSB15B

thymosin beta 15B

Synonyms: Tbeta15b
UniProtKB ID: P0CG35, A8K614, Q99406
Gene ID:
sheep(101121750) thymosin beta 15B
Gene Class: Cytoskeleton
208 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_194324 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_194324 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_194324 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU100341 MISSION® esiRNA esiRNA human AL034485.16 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_194324 Rosetta Predictions human pricing
XR_042096 Rosetta Predictions human pricing
XR_042097 Rosetta Predictions human pricing
XR_042098 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_194324 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00371464 predicted 364
2 SASI_Hs02_00371465 predicted 435
3 SASI_Hs02_00371466 predicted 431
4 SASI_Hs02_00371467 predicted 394
5 SASI_Hs02_00371468 predicted 256
6 SASI_Hs02_00371469 predicted 348
7 SASI_Hs02_00371470 predicted 275
8 SASI_Hs02_00371471 predicted 369
9 SASI_Hs02_00371472 predicted 333
10 SASI_Hs02_00371473 predicted 258
11 SASI_Hs01_00128768 predicted 393
12 SASI_Hs01_00128769 predicted 288
13 SASI_Hs01_00128770 predicted 472
14 SASI_Hs01_00128771 predicted 430
15 SASI_Hs01_00128772 predicted 286
16 SASI_Hs01_00128773 predicted 278
17 SASI_Hs01_00128774 predicted 603
18 SASI_Hs01_00128775 predicted 579
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_042096 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00533035 predicted 375
2 SASI_Hs02_00533036 predicted 279
3 SASI_Hs02_00533037 predicted 457
4 SASI_Hs02_00533038 predicted 418
5 SASI_Hs02_00533039 predicted 269
6 SASI_Hs02_00533040 predicted 261
7 SASI_Hs02_00533041 predicted 590
8 SASI_Hs02_00533042 predicted 565
9 SASI_Hs02_00533043 predicted 632
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_042097 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00533044 predicted 258
2 SASI_Hs02_00533045 predicted 258
3 SASI_Hs02_00533046 predicted 316
4 SASI_Hs02_00533047 predicted 314
5 SASI_Hs02_00533048 predicted 310
6 SASI_Hs02_00533049 predicted 323
7 SASI_Hs02_00533050 predicted 285
8 SASI_Hs02_00533051 predicted 284
9 SASI_Hs02_00533052 predicted 212
10 SASI_Hs02_00533053 predicted 313
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_042098 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00533054 predicted 249
2 SASI_Hs02_00533055 predicted 258
3 SASI_Hs02_00533056 predicted 319
4 SASI_Hs02_00533057 predicted 317
5 SASI_Hs02_00533058 predicted 315
6 SASI_Hs02_00533059 predicted 324
7 SASI_Hs02_00533060 predicted 289
8 SASI_Hs02_00533061 predicted 279
9 SASI_Hs02_00533062 predicted 208
10 SASI_Hs02_00533063 predicted 313
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_194324
VALIDATED
TMSB15B MISSION shRNA Bacterial Glycerol Stock
thymosin beta 15B
Human
18 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000142696    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_194324.1-224s1c1
Sequence:CCGGCGATATGGCAAGAGAGAAAGTCTCGAGACTTTCTCTCTTGCCATATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141476    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_194324.1-1082s1c1
Sequence:CCGGCCAACACATAGCCACATAGATCTCGAGATCTATGTGGCTATGTGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139315    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194324.1-280s1c1
Sequence:CCGGCCTTCCAGATGTGTGTCAGTACTCGAGTACTGACACACATCTGGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139134    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_194324.1-1516s1c1
Sequence:CCGGCCACATCTCACTCAGTGACTTCTCGAGAAGTCACTGAGTGAGATGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139356    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_194324.1-815s1c1
Sequence:CCGGCCGAGTATGTGGACAAGAGAACTCGAGTTCTCTTGTCCACATACTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139899    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_194324.1-268s1c1
Sequence:CCGGGAAACCTTCCTTCCTTCCAGACTCGAGTCTGGAAGGAAGGAAGGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141334    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_194324.1-465s1c1
Sequence:CCGGGCATGGCGATGTGATTCTTTACTCGAGTAAAGAATCACATCGCCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142528    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_194324.1-235s1c1
Sequence:CCGGGAGAGAAAGTGAATACGCTGACTCGAGTCAGCGTATTCACTTTCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144895    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194324.1-237s1c1
Sequence:CCGGGAGAAAGTGAATACGCTGATACTCGAGTATCAGCGTATTCACTTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000377321    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_194324.2-489s21c1
Sequence:CCGGTGACCTTTGTGTAGGTAGTCCCTCGAGGGACTACCTACACAAAGGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000369509    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_194324.2-372s21c1
Sequence:CCGGCCTATATTCCCTGGTTAAGAGCTCGAGCTCTTAACCAGGGAATATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000369507    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_194324.2-281s21c1
Sequence:CCGGTCAGCATTGCCTGACAGTCTTCTCGAGAAGACTGTCAGGCAATGCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364760    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_194324.2-431s21c1
Sequence:CCGGACTTCCCATTGGTATGTAAATCTCGAGATTTACATACCAATGGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364704    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_194324.2-401s21c1
Sequence:CCGGTAGTGAATGTTTCCTTAAGTTCTCGAGAACTTAAGGAAACATTCACTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364706    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_194324.2-359s21c1
Sequence:CCGGTGATTTCTTCTCACCTATATTCTCGAGAATATAGGTGAGAAGAAATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364705    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_194324.2-476s21c1
Sequence:CCGGACCTTGCCATGGATGACCTTTCTCGAGAAAGGTCATCCATGGCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364763    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_194324.2-261s21c1
Sequence:CCGGTCTCCTCCAAAGAGCAGATTTCTCGAGAAATCTGCTCTTTGGAGGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000369508    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_194324.2-445s21c1
Sequence:CCGGTGTAAATTCCAAATGGCAGATCTCGAGATCTGCCATTTGGAATTTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_194324
VALIDATED
TMSB15B MISSION shRNA shRNA Plasmid DNA
thymosin beta 15B
Human
18 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000142696    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_194324.1-224s1c1
Sequence:CCGGCGATATGGCAAGAGAGAAAGTCTCGAGACTTTCTCTCTTGCCATATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141476    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_194324.1-1082s1c1
Sequence:CCGGCCAACACATAGCCACATAGATCTCGAGATCTATGTGGCTATGTGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139315    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194324.1-280s1c1
Sequence:CCGGCCTTCCAGATGTGTGTCAGTACTCGAGTACTGACACACATCTGGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139134    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_194324.1-1516s1c1
Sequence:CCGGCCACATCTCACTCAGTGACTTCTCGAGAAGTCACTGAGTGAGATGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139356    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_194324.1-815s1c1
Sequence:CCGGCCGAGTATGTGGACAAGAGAACTCGAGTTCTCTTGTCCACATACTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139899    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_194324.1-268s1c1
Sequence:CCGGGAAACCTTCCTTCCTTCCAGACTCGAGTCTGGAAGGAAGGAAGGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141334    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_194324.1-465s1c1
Sequence:CCGGGCATGGCGATGTGATTCTTTACTCGAGTAAAGAATCACATCGCCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142528    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_194324.1-235s1c1
Sequence:CCGGGAGAGAAAGTGAATACGCTGACTCGAGTCAGCGTATTCACTTTCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144895    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194324.1-237s1c1
Sequence:CCGGGAGAAAGTGAATACGCTGATACTCGAGTATCAGCGTATTCACTTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000377321    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_194324.2-489s21c1
Sequence:CCGGTGACCTTTGTGTAGGTAGTCCCTCGAGGGACTACCTACACAAAGGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000369509    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_194324.2-372s21c1
Sequence:CCGGCCTATATTCCCTGGTTAAGAGCTCGAGCTCTTAACCAGGGAATATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000369507    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_194324.2-281s21c1
Sequence:CCGGTCAGCATTGCCTGACAGTCTTCTCGAGAAGACTGTCAGGCAATGCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364760    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_194324.2-431s21c1
Sequence:CCGGACTTCCCATTGGTATGTAAATCTCGAGATTTACATACCAATGGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364704    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_194324.2-401s21c1
Sequence:CCGGTAGTGAATGTTTCCTTAAGTTCTCGAGAACTTAAGGAAACATTCACTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364706    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_194324.2-359s21c1
Sequence:CCGGTGATTTCTTCTCACCTATATTCTCGAGAATATAGGTGAGAAGAAATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364705    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_194324.2-476s21c1
Sequence:CCGGACCTTGCCATGGATGACCTTTCTCGAGAAAGGTCATCCATGGCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364763    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_194324.2-261s21c1
Sequence:CCGGTCTCCTCCAAAGAGCAGATTTCTCGAGAAATCTGCTCTTTGGAGGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000369508    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_194324.2-445s21c1
Sequence:CCGGTGTAAATTCCAAATGGCAGATCTCGAGATCTGCCATTTGGAATTTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_194324
VALIDATED
TMSB15B MISSION shRNA Lentiviral Transduction Particles
thymosin beta 15B
Human
18 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000142696    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_194324.1-224s1c1
Sequence:CCGGCGATATGGCAAGAGAGAAAGTCTCGAGACTTTCTCTCTTGCCATATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141476    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_194324.1-1082s1c1
Sequence:CCGGCCAACACATAGCCACATAGATCTCGAGATCTATGTGGCTATGTGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139315    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194324.1-280s1c1
Sequence:CCGGCCTTCCAGATGTGTGTCAGTACTCGAGTACTGACACACATCTGGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139134    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_194324.1-1516s1c1
Sequence:CCGGCCACATCTCACTCAGTGACTTCTCGAGAAGTCACTGAGTGAGATGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139356    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_194324.1-815s1c1
Sequence:CCGGCCGAGTATGTGGACAAGAGAACTCGAGTTCTCTTGTCCACATACTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139899    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_194324.1-268s1c1
Sequence:CCGGGAAACCTTCCTTCCTTCCAGACTCGAGTCTGGAAGGAAGGAAGGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141334    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_194324.1-465s1c1
Sequence:CCGGGCATGGCGATGTGATTCTTTACTCGAGTAAAGAATCACATCGCCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142528    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_194324.1-235s1c1
Sequence:CCGGGAGAGAAAGTGAATACGCTGACTCGAGTCAGCGTATTCACTTTCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144895    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194324.1-237s1c1
Sequence:CCGGGAGAAAGTGAATACGCTGATACTCGAGTATCAGCGTATTCACTTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000377321    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_194324.2-489s21c1
Sequence:CCGGTGACCTTTGTGTAGGTAGTCCCTCGAGGGACTACCTACACAAAGGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000369509    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_194324.2-372s21c1
Sequence:CCGGCCTATATTCCCTGGTTAAGAGCTCGAGCTCTTAACCAGGGAATATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000369507    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_194324.2-281s21c1
Sequence:CCGGTCAGCATTGCCTGACAGTCTTCTCGAGAAGACTGTCAGGCAATGCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364760    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_194324.2-431s21c1
Sequence:CCGGACTTCCCATTGGTATGTAAATCTCGAGATTTACATACCAATGGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364704    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_194324.2-401s21c1
Sequence:CCGGTAGTGAATGTTTCCTTAAGTTCTCGAGAACTTAAGGAAACATTCACTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364706    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_194324.2-359s21c1
Sequence:CCGGTGATTTCTTCTCACCTATATTCTCGAGAATATAGGTGAGAAGAAATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364705    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_194324.2-476s21c1
Sequence:CCGGACCTTGCCATGGATGACCTTTCTCGAGAAAGGTCATCCATGGCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364763    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_194324.2-261s21c1
Sequence:CCGGTCTCCTCCAAAGAGCAGATTTCTCGAGAAATCTGCTCTTTGGAGGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000369508    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_194324.2-445s21c1
Sequence:CCGGTGTAAATTCCAAATGGCAGATCTCGAGATCTGCCATTTGGAATTTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks