EMAIL THIS PAGE TO A FRIEND

TMSB4X

thymosin beta 4, X-linked

Synonyms: FX PTMB4 TB4X TMSB4
UniProtKB ID: P62328, P01253, P01254, Q546P5, Q63576, Q9UE55
Gene ID:
Human(7114) Summary: This gene encodes an actin sequestering protein which plays a role in regulation of actin polymerization. The protein is also involved in cell proliferation, migration, and differentiation. This gene escapes X inactivation and has a homolog on chromosome Y. [provided by RefSeq, Jul 2008]
Mouse(19241) thymosin, beta 4, X chromosome
Rat(81814) thymosin, beta 4, X chromosome
cow(282386) thymosin beta 4, X-linked
sheep(101119695) thymosin beta 4, X-linked
domestic guinea pig(100736168) thymosin beta 4, X-linked
naked mole-rat(101726037) thymosin beta 4, X-linked
chicken(408047) thymosin beta 4, X-linked
Horse(100034015) thymosin beta 4, X-linked
domestic cat(101088815) thymosin beta 4, X-linked
89 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1406539 Anti-TMSB4X antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
immunofluorescence, western blot pricing
SAB4301048 Anti-TMSB4X antibody produced in rabbit affinity isolated antibody rat, human, mouse
immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_021278 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_021278 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_021278 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_021109 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_021109 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_021109 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU117901 MISSION® esiRNA esiRNA human TMSB4X (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_021109 Rosetta Predictions human pricing
NM_031136 Rosetta Predictions rat pricing
NM_021278 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021109 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00354602 predicted 514
2 SASI_Hs02_00354603 predicted 507
3 SASI_Hs01_00151015 predicted 313
4 SASI_Hs01_00151016 predicted 300
5 SASI_Hs01_00151017 predicted 221
6 SASI_Hs01_00151018 predicted 219
7 SASI_Hs01_00151019 predicted 220
8 SASI_Hs01_00151020 predicted 292
9 SASI_Hs01_00151021 predicted 225
10 SASI_Hs01_00151022 predicted 221
11 SASI_Hs01_00151023 predicted 301
12 SASI_Hs01_00151024 predicted 231
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031136 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00264463 predicted 292
2 SASI_Rn01_00119925 predicted 200
3 SASI_Rn02_00264464 predicted 264
4 SASI_Rn01_00119926 predicted 203
5 SASI_Rn01_00119927 predicted 203
6 SASI_Rn01_00119928 predicted 230
7 SASI_Rn01_00119929 predicted 226
8 SASI_Rn02_00264465 predicted 280
9 SASI_Rn01_00119930 predicted 202
10 SASI_Rn01_00119931 predicted 197
11 SASI_Rn01_00119932 predicted 208
12 SASI_Rn01_00119933 predicted 210
13 SASI_Rn01_00119934 predicted 223
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021278 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00163777 predicted 267
2 SASI_Mm01_00163778 predicted 267
3 SASI_Mm01_00163779 predicted 241
4 SASI_Mm01_00163780 predicted 268
5 SASI_Mm01_00163781 predicted 291
6 SASI_Mm01_00163782 predicted 338
7 SASI_Mm01_00163783 predicted 272
8 SASI_Mm01_00163784 predicted 239
9 SASI_Mm01_00163785 predicted 263
10 SASI_Mm01_00163786 predicted 257
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021278
TMSB4X MISSION shRNA Bacterial Glycerol Stock
thymosin beta 4, X-linked
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000011838    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021278.1-326s1c1
Sequence:CCGGCCACGAGCATTGCCTTCTTATCTCGAGATAAGAAGGCAATGCTCGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011841    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021278.1-270s1c1
Sequence:CCGGAGAAGCAAGCTGGCGAATCGTCTCGAGACGATTCGCCAGCTTGCTTCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011842    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021278.1-193s1c1
Sequence:CCGGATTCGATAAGTCGAAGTTGAACTCGAGTTCAACTTCGACTTATCGAATTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011839    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021278.1-187s1c1
Sequence:CCGGCGAGAAATTCGATAAGTCGAACTCGAGTTCGACTTATCGAATTTCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429031    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021278.2-355s21c1
Sequence:CCGGAGAGGTTGGATCAAGTTTAAACTCGAGTTTAAACTTGATCCAACCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415861    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021278.2-393s21c1
Sequence:CCGGTCACATCAAAGAATCAGAACTCTCGAGAGTTCTGATTCTTTGATGTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414205    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021278.2-129s21c1
Sequence:CCGGATGTCTGACAAACCCGATATGCTCGAGCATATCGGGTTTGTCAGACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021278
TMSB4X MISSION shRNA shRNA Plasmid DNA
thymosin beta 4, X-linked
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000011838    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021278.1-326s1c1
Sequence:CCGGCCACGAGCATTGCCTTCTTATCTCGAGATAAGAAGGCAATGCTCGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011841    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021278.1-270s1c1
Sequence:CCGGAGAAGCAAGCTGGCGAATCGTCTCGAGACGATTCGCCAGCTTGCTTCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011842    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021278.1-193s1c1
Sequence:CCGGATTCGATAAGTCGAAGTTGAACTCGAGTTCAACTTCGACTTATCGAATTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011839    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021278.1-187s1c1
Sequence:CCGGCGAGAAATTCGATAAGTCGAACTCGAGTTCGACTTATCGAATTTCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429031    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021278.2-355s21c1
Sequence:CCGGAGAGGTTGGATCAAGTTTAAACTCGAGTTTAAACTTGATCCAACCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415861    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021278.2-393s21c1
Sequence:CCGGTCACATCAAAGAATCAGAACTCTCGAGAGTTCTGATTCTTTGATGTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414205    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021278.2-129s21c1
Sequence:CCGGATGTCTGACAAACCCGATATGCTCGAGCATATCGGGTTTGTCAGACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021278
TMSB4X MISSION shRNA Lentiviral Transduction Particles
thymosin beta 4, X-linked
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000011838    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021278.1-326s1c1
Sequence:CCGGCCACGAGCATTGCCTTCTTATCTCGAGATAAGAAGGCAATGCTCGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011841    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021278.1-270s1c1
Sequence:CCGGAGAAGCAAGCTGGCGAATCGTCTCGAGACGATTCGCCAGCTTGCTTCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011842    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021278.1-193s1c1
Sequence:CCGGATTCGATAAGTCGAAGTTGAACTCGAGTTCAACTTCGACTTATCGAATTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011839    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021278.1-187s1c1
Sequence:CCGGCGAGAAATTCGATAAGTCGAACTCGAGTTCGACTTATCGAATTTCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429031    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021278.2-355s21c1
Sequence:CCGGAGAGGTTGGATCAAGTTTAAACTCGAGTTTAAACTTGATCCAACCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415861    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021278.2-393s21c1
Sequence:CCGGTCACATCAAAGAATCAGAACTCTCGAGAGTTCTGATTCTTTGATGTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414205    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021278.2-129s21c1
Sequence:CCGGATGTCTGACAAACCCGATATGCTCGAGCATATCGGGTTTGTCAGACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021109
VALIDATED
TMSB4X MISSION shRNA Bacterial Glycerol Stock
thymosin beta 4, X-linked
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000164355    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_021109.2-178s1c1
Sequence:CCGGCGATTGAACAGGAGAAGCAAGCTCGAGCTTGCTTCTCCTGTTCAATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158860    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_021109.2-108s1c1
Sequence:CCGGGAGAAATTCGATAAGTCGAAACTCGAGTTTCGACTTATCGAATTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161935    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_021109.2-300s1c1
Sequence:CCGGGCAAAGAGGTTGGATCAAGTTCTCGAGAACTTGATCCAACCTCTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160767    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_021109.2-124s1c1
Sequence:CCGGCGAAACTGAAGAAGACAGAGACTCGAGTCTCTGTCTTCTTCAGTTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160634    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021109.2-170s1c1
Sequence:CCGGCAAAGAAACGATTGAACAGGACTCGAGTCCTGTTCAATCGTTTCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159228    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_021109.2-116s1c1
Sequence:CCGGCGATAAGTCGAAACTGAAGAACTCGAGTTCTTCAGTTTCGACTTATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161561    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_021109.2-122s1c1
Sequence:CCGGGTCGAAACTGAAGAAGACAGACTCGAGTCTGTCTTCTTCAGTTTCGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163494    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_021109.2-134s1c1
Sequence:CCGGGAAGACAGAGACGCAAGAGAACTCGAGTTCTCTTGCGTCTCTGTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219784    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_021109.3-79s1c1
Sequence:CCGGATGTCTGACAAACCCGATATGCTCGAGCATATCGGGTTTGTCAGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219785    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_021109.3-249s1c1
Sequence:CCGGACAAGCATTGCCTTCTTATTTCTCGAGAAATAAGAAGGCAATGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021109
VALIDATED
TMSB4X MISSION shRNA shRNA Plasmid DNA
thymosin beta 4, X-linked
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000164355    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_021109.2-178s1c1
Sequence:CCGGCGATTGAACAGGAGAAGCAAGCTCGAGCTTGCTTCTCCTGTTCAATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158860    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_021109.2-108s1c1
Sequence:CCGGGAGAAATTCGATAAGTCGAAACTCGAGTTTCGACTTATCGAATTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161935    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_021109.2-300s1c1
Sequence:CCGGGCAAAGAGGTTGGATCAAGTTCTCGAGAACTTGATCCAACCTCTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160767    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_021109.2-124s1c1
Sequence:CCGGCGAAACTGAAGAAGACAGAGACTCGAGTCTCTGTCTTCTTCAGTTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160634    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021109.2-170s1c1
Sequence:CCGGCAAAGAAACGATTGAACAGGACTCGAGTCCTGTTCAATCGTTTCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159228    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_021109.2-116s1c1
Sequence:CCGGCGATAAGTCGAAACTGAAGAACTCGAGTTCTTCAGTTTCGACTTATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161561    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_021109.2-122s1c1
Sequence:CCGGGTCGAAACTGAAGAAGACAGACTCGAGTCTGTCTTCTTCAGTTTCGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163494    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_021109.2-134s1c1
Sequence:CCGGGAAGACAGAGACGCAAGAGAACTCGAGTTCTCTTGCGTCTCTGTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219784    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_021109.3-79s1c1
Sequence:CCGGATGTCTGACAAACCCGATATGCTCGAGCATATCGGGTTTGTCAGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219785    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_021109.3-249s1c1
Sequence:CCGGACAAGCATTGCCTTCTTATTTCTCGAGAAATAAGAAGGCAATGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021109
VALIDATED
TMSB4X MISSION shRNA Lentiviral Transduction Particles
thymosin beta 4, X-linked
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000164355    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_021109.2-178s1c1
Sequence:CCGGCGATTGAACAGGAGAAGCAAGCTCGAGCTTGCTTCTCCTGTTCAATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158860    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_021109.2-108s1c1
Sequence:CCGGGAGAAATTCGATAAGTCGAAACTCGAGTTTCGACTTATCGAATTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161935    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_021109.2-300s1c1
Sequence:CCGGGCAAAGAGGTTGGATCAAGTTCTCGAGAACTTGATCCAACCTCTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160767    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_021109.2-124s1c1
Sequence:CCGGCGAAACTGAAGAAGACAGAGACTCGAGTCTCTGTCTTCTTCAGTTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160634    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021109.2-170s1c1
Sequence:CCGGCAAAGAAACGATTGAACAGGACTCGAGTCCTGTTCAATCGTTTCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159228    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_021109.2-116s1c1
Sequence:CCGGCGATAAGTCGAAACTGAAGAACTCGAGTTCTTCAGTTTCGACTTATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161561    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_021109.2-122s1c1
Sequence:CCGGGTCGAAACTGAAGAAGACAGACTCGAGTCTGTCTTCTTCAGTTTCGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163494    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_021109.2-134s1c1
Sequence:CCGGGAAGACAGAGACGCAAGAGAACTCGAGTTCTCTTGCGTCTCTGTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219784    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_021109.3-79s1c1
Sequence:CCGGATGTCTGACAAACCCGATATGCTCGAGCATATCGGGTTTGTCAGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219785    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_021109.3-249s1c1
Sequence:CCGGACAAGCATTGCCTTCTTATTTCTCGAGAAATAAGAAGGCAATGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks