EMAIL THIS PAGE TO A FRIEND

TMSB4XP8

thymosin beta 4, X-linked pseudogene 8

Synonyms: TMSL3
Species: Human TMSB4XP8(7117)
Gene ID:
59 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_183049 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_183049 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_183049 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU118151 MISSION® esiRNA esiRNA human TMSL3 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_183049 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_183049 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00371211 predicted 515
2 SASI_Hs02_00371212 predicted 378
3 SASI_Hs02_00371213 predicted 510
4 SASI_Hs01_00152863 predicted 312
5 SASI_Hs01_00152864 predicted 227
6 SASI_Hs01_00152865 predicted 230
7 SASI_Hs01_00152866 predicted 305
8 SASI_Hs01_00152867 predicted 215
9 SASI_Hs01_00152868 predicted 305
10 SASI_Hs01_00152869 predicted 227
11 SASI_Hs01_00152870 predicted 312
12 SASI_Hs01_00152871 predicted 199
13 SASI_Hs01_00152872 predicted 219
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_183049
VALIDATED
TMSB4XP8 MISSION shRNA Bacterial Glycerol Stock
thymosin beta 4, X-linked pseudogene 8
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000428464    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_183049.2-343s21c1
Sequence:CCGGCTTTCACATCAAAGAACTACTCTCGAGAGTAGTTCTTTGATGTGAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421069    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183049.2-197s21c1
Sequence:CCGGAGCAAGCAGGCGAATCGTAATCTCGAGATTACGATTCGCCTGCTTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423070    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183049.2-135s21c1
Sequence:CCGGGAAGAAGACAGAGACGCAAGACTCGAGTCTTGCGTCTCTGTCTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427838    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_183049.2-422s21c1
Sequence:CCGGGAACTTGCATGTTGGTGAAGGCTCGAGCCTTCACCAACATGCAAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149851    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_183049.1-162s1c1
Sequence:CCGGCTGCCTTCCAAAGAAACGATTCTCGAGAATCGTTTCTTTGGAAGGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149074    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_183049.1-300s1c1
Sequence:CCGGGCAAAGAGGTTGGATCAAGTTCTCGAGAACTTGATCCAACCTCTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147117    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183049.1-170s1c1
Sequence:CCGGCAAAGAAACGATTGAACAGGACTCGAGTCCTGTTCAATCGTTTCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146475    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_183049.1-246s1c1
Sequence:CCGGCCACAAGCATTGCCTTCTTATCTCGAGATAAGAAGGCAATGCTTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146656    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_183049.1-165s1c1
Sequence:CCGGCCTTCCAAAGAAACGATTGAACTCGAGTTCAATCGTTTCTTTGGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148715    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183049.1-107s1c1
Sequence:CCGGCGAGAAATTCGATAAGCCGAACTCGAGTTCGGCTTATCGAATTTCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_183049
VALIDATED
TMSB4XP8 MISSION shRNA shRNA Plasmid DNA
thymosin beta 4, X-linked pseudogene 8
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000428464    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_183049.2-343s21c1
Sequence:CCGGCTTTCACATCAAAGAACTACTCTCGAGAGTAGTTCTTTGATGTGAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421069    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183049.2-197s21c1
Sequence:CCGGAGCAAGCAGGCGAATCGTAATCTCGAGATTACGATTCGCCTGCTTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423070    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183049.2-135s21c1
Sequence:CCGGGAAGAAGACAGAGACGCAAGACTCGAGTCTTGCGTCTCTGTCTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427838    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_183049.2-422s21c1
Sequence:CCGGGAACTTGCATGTTGGTGAAGGCTCGAGCCTTCACCAACATGCAAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149851    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_183049.1-162s1c1
Sequence:CCGGCTGCCTTCCAAAGAAACGATTCTCGAGAATCGTTTCTTTGGAAGGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149074    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_183049.1-300s1c1
Sequence:CCGGGCAAAGAGGTTGGATCAAGTTCTCGAGAACTTGATCCAACCTCTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147117    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183049.1-170s1c1
Sequence:CCGGCAAAGAAACGATTGAACAGGACTCGAGTCCTGTTCAATCGTTTCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146475    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_183049.1-246s1c1
Sequence:CCGGCCACAAGCATTGCCTTCTTATCTCGAGATAAGAAGGCAATGCTTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146656    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_183049.1-165s1c1
Sequence:CCGGCCTTCCAAAGAAACGATTGAACTCGAGTTCAATCGTTTCTTTGGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148715    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183049.1-107s1c1
Sequence:CCGGCGAGAAATTCGATAAGCCGAACTCGAGTTCGGCTTATCGAATTTCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_183049
VALIDATED
TMSB4XP8 MISSION shRNA Lentiviral Transduction Particles
thymosin beta 4, X-linked pseudogene 8
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000428464    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_183049.2-343s21c1
Sequence:CCGGCTTTCACATCAAAGAACTACTCTCGAGAGTAGTTCTTTGATGTGAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421069    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183049.2-197s21c1
Sequence:CCGGAGCAAGCAGGCGAATCGTAATCTCGAGATTACGATTCGCCTGCTTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423070    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183049.2-135s21c1
Sequence:CCGGGAAGAAGACAGAGACGCAAGACTCGAGTCTTGCGTCTCTGTCTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427838    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_183049.2-422s21c1
Sequence:CCGGGAACTTGCATGTTGGTGAAGGCTCGAGCCTTCACCAACATGCAAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149851    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_183049.1-162s1c1
Sequence:CCGGCTGCCTTCCAAAGAAACGATTCTCGAGAATCGTTTCTTTGGAAGGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149074    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_183049.1-300s1c1
Sequence:CCGGGCAAAGAGGTTGGATCAAGTTCTCGAGAACTTGATCCAACCTCTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147117    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183049.1-170s1c1
Sequence:CCGGCAAAGAAACGATTGAACAGGACTCGAGTCCTGTTCAATCGTTTCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146475    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_183049.1-246s1c1
Sequence:CCGGCCACAAGCATTGCCTTCTTATCTCGAGATAAGAAGGCAATGCTTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146656    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_183049.1-165s1c1
Sequence:CCGGCCTTCCAAAGAAACGATTGAACTCGAGTTCAATCGTTTCTTTGGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148715    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183049.1-107s1c1
Sequence:CCGGCGAGAAATTCGATAAGCCGAACTCGAGTTCGGCTTATCGAATTTCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks