EMAIL THIS PAGE TO A FRIEND

TMSB4Y

thymosin beta 4, Y-linked

Synonyms: TB4Y
Species: Human TMSB4Y(9087)
UniProtKB ID: O14604, Q0VDA2
Gene ID:
Human(9087) Summary: This gene lies within the male specific region of chromosome Y. Its homolog on chromosome X escapes X inactivation and encodes an actin sequestering protein. [provided by RefSeq, Jul 2008]
68 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1403013 Monoclonal Anti-TMSB4Y antibody produced in mouse clone 6G4, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004202 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004202 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004202 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU036141 MISSION® esiRNA esiRNA human TMSB4Y (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004202 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004202 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00183280 predicted 877
2 SASI_Hs01_00183281 predicted 996
3 SASI_Hs01_00183282 predicted 841
4 SASI_Hs01_00183283 predicted 914
5 SASI_Hs01_00183284 predicted 906
6 SASI_Hs01_00183285 predicted 838
7 SASI_Hs01_00183286 predicted 986
8 SASI_Hs02_00337099 predicted 1179
9 SASI_Hs01_00183287 predicted 778
10 SASI_Hs01_00183288 predicted 1171
11 SASI_Hs01_00183289 predicted 841
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004202
TMSB4Y MISSION shRNA Bacterial Glycerol Stock
thymosin beta 4, Y-linked
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000156038    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004202.2-821s1c1
Sequence:CCGGCTGAAGAAGACAGAAACGCAACTCGAGTTGCGTTTCTGTCTTCTTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155193    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004202.2-826s1c1
Sequence:CCGGGAAGACAGAAACGCAAGAGAACTCGAGTTCTCTTGCGTTTCTGTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154900    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004202.2-833s1c1
Sequence:CCGGGAAACGCAAGAGAAGAATCCACTCGAGTGGATTCTTCTCTTGCGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150734    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004202.2-847s1c1
Sequence:CCGGGAATCCATTGTCTTCCAAAGACTCGAGTCTTTGGAAGACAATGGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150369    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004202.2-808s1c1
Sequence:CCGGCGATAAGTCGAAACTGAAGAACTCGAGTTCTTCAGTTTCGACTTATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151641    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004202.2-816s1c1
Sequence:CCGGCGAAACTGAAGAAGACAGAAACTCGAGTTTCTGTCTTCTTCAGTTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155476    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004202.2-838s1c1
Sequence:CCGGGCAAGAGAAGAATCCATTGTCCTCGAGGACAATGGATTCTTCTCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154528    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004202.2-992s1c1
Sequence:CCGGGCAAACACGTTGGATGAGTTTCTCGAGAAACTCATCCAACGTGTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435326    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004202.2-1380s21c1
Sequence:CCGGCACAGGCAAAGAATAACTTAACTCGAGTTAAGTTATTCTTTGCCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004202
TMSB4Y MISSION shRNA shRNA Plasmid DNA
thymosin beta 4, Y-linked
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000156038    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004202.2-821s1c1
Sequence:CCGGCTGAAGAAGACAGAAACGCAACTCGAGTTGCGTTTCTGTCTTCTTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155193    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004202.2-826s1c1
Sequence:CCGGGAAGACAGAAACGCAAGAGAACTCGAGTTCTCTTGCGTTTCTGTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154900    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004202.2-833s1c1
Sequence:CCGGGAAACGCAAGAGAAGAATCCACTCGAGTGGATTCTTCTCTTGCGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150734    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004202.2-847s1c1
Sequence:CCGGGAATCCATTGTCTTCCAAAGACTCGAGTCTTTGGAAGACAATGGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150369    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004202.2-808s1c1
Sequence:CCGGCGATAAGTCGAAACTGAAGAACTCGAGTTCTTCAGTTTCGACTTATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151641    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004202.2-816s1c1
Sequence:CCGGCGAAACTGAAGAAGACAGAAACTCGAGTTTCTGTCTTCTTCAGTTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155476    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004202.2-838s1c1
Sequence:CCGGGCAAGAGAAGAATCCATTGTCCTCGAGGACAATGGATTCTTCTCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154528    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004202.2-992s1c1
Sequence:CCGGGCAAACACGTTGGATGAGTTTCTCGAGAAACTCATCCAACGTGTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435326    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004202.2-1380s21c1
Sequence:CCGGCACAGGCAAAGAATAACTTAACTCGAGTTAAGTTATTCTTTGCCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004202
TMSB4Y MISSION shRNA Lentiviral Transduction Particles
thymosin beta 4, Y-linked
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000156038    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004202.2-821s1c1
Sequence:CCGGCTGAAGAAGACAGAAACGCAACTCGAGTTGCGTTTCTGTCTTCTTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155193    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004202.2-826s1c1
Sequence:CCGGGAAGACAGAAACGCAAGAGAACTCGAGTTCTCTTGCGTTTCTGTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154900    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004202.2-833s1c1
Sequence:CCGGGAAACGCAAGAGAAGAATCCACTCGAGTGGATTCTTCTCTTGCGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150734    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004202.2-847s1c1
Sequence:CCGGGAATCCATTGTCTTCCAAAGACTCGAGTCTTTGGAAGACAATGGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150369    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004202.2-808s1c1
Sequence:CCGGCGATAAGTCGAAACTGAAGAACTCGAGTTCTTCAGTTTCGACTTATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151641    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004202.2-816s1c1
Sequence:CCGGCGAAACTGAAGAAGACAGAAACTCGAGTTTCTGTCTTCTTCAGTTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155476    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004202.2-838s1c1
Sequence:CCGGGCAAGAGAAGAATCCATTGTCCTCGAGGACAATGGATTCTTCTCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154528    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004202.2-992s1c1
Sequence:CCGGGCAAACACGTTGGATGAGTTTCTCGAGAAACTCATCCAACGTGTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435326    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004202.2-1380s21c1
Sequence:CCGGCACAGGCAAAGAATAACTTAACTCGAGTTAAGTTATTCTTTGCCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks