EMAIL THIS PAGE TO A FRIEND

TMTC1

transmembrane and tetratricopeptide repeat containing 1

Synonyms: OLF TMTC1A
Gene ID:
Mouse(387314) transmembrane and tetratricopeptide repeat containing 1
Rat(362465) transmembrane and tetratricopeptide repeat containing 1
chicken(418143) transmembrane and tetratricopeptide repeat containing 1
dog(486621) transmembrane and tetratricopeptide repeat containing 1
Horse(100064815) transmembrane and tetratricopeptide repeat containing 1
domestic guinea pig(100715301) transmembrane and tetratricopeptide repeat containing 1
naked mole-rat(101698394) transmembrane and tetratricopeptide repeat containing 1
cow(533191) transmembrane and tetratricopeptide repeat containing 1
sheep(101108298) transmembrane and tetratricopeptide repeat containing 1
130 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_175861 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_175861 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_175861 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_031920 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_031920 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_031920 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_198967 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_198967 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_198967 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU082491 MISSION® esiRNA esiRNA human TMTC1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_175861 Rosetta Predictions human pricing
XM_001075561 Rosetta Predictions rat pricing
XM_342788 Rosetta Predictions rat pricing
NM_198967 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175861 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00139947 predicted 1169
2 SASI_Hs01_00139948 predicted 2203
3 SASI_Hs01_00139949 predicted 1557
4 SASI_Hs01_00139950 predicted 1191
5 SASI_Hs01_00139952 predicted 2180
6 SASI_Hs01_00139953 predicted 1545
7 SASI_Hs02_00369136 predicted 2365
8 SASI_Hs01_00139955 predicted 1869
9 SASI_Hs01_00139956 predicted 529
10 SASI_Hs02_00369137 predicted 2634
11 SASI_Hs01_00139951 predicted 2683
12 SASI_Hs01_00139954 predicted 1239
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001075561 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00350258 predicted 2086
2 SASI_Rn02_00350259 predicted 1183
3 SASI_Rn02_00350260 predicted 1292
4 SASI_Rn02_00350261 predicted 2056
5 SASI_Rn02_00350262 predicted 1907
6 SASI_Rn02_00350263 predicted 1145
7 SASI_Rn02_00350264 predicted 1583
8 SASI_Rn02_00350265 predicted 1384
9 SASI_Rn02_00350266 predicted 2455
10 SASI_Rn02_00350267 predicted 1404
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_342788 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00394811 predicted 2596
2 SASI_Rn02_00394812 predicted 2579
3 SASI_Rn02_00394813 predicted 2591
4 SASI_Rn02_00394814 predicted 2584
5 SASI_Rn02_00394815 predicted 2570
6 SASI_Rn02_00394816 predicted 2582
7 SASI_Rn02_00394817 predicted 2598
8 SASI_Rn02_00394818 predicted 1893
9 SASI_Rn02_00394819 predicted 997
10 SASI_Rn02_00394820 predicted 265
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198967 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00142909 predicted 2960
2 SASI_Mm01_00142910 predicted 1114
3 SASI_Mm01_00142913 predicted 1255
4 SASI_Mm01_00142914 predicted 2856
5 SASI_Mm01_00142915 predicted 2047
6 SASI_Mm01_00142916 predicted 1476
7 SASI_Mm01_00142918 predicted 2936
8 SASI_Mm02_00351251 predicted 479
9 SASI_Mm02_00351252 predicted 1421
10 SASI_Mm02_00351253 predicted 822
11 SASI_Mm01_00142911 predicted 2622
12 SASI_Mm01_00142912 predicted 1109
13 SASI_Mm01_00142917 predicted 1157
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175861
TMTC1 MISSION shRNA Bacterial Glycerol Stock
transmembrane and tetratricopeptide repeat containing 1
Human
2 Products Total
TRC Number Price Set Price (2)? Select
TRCN0000436579    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175861.2-3102s21c1
Sequence:CCGGTTGAGACCTGGAGATCTAATTCTCGAGAATTAGATCTCCAGGTCTCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412975    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175861.2-1927s21c1
Sequence:CCGGGCTGAGCAGGAGCGGTTTAAACTCGAGTTTAAACCGCTCCTGCTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175861
TMTC1 MISSION shRNA shRNA Plasmid DNA
transmembrane and tetratricopeptide repeat containing 1
Human
2 Products Total
TRC Number Vector Price Set Price (2)? Select
TRCN0000436579    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175861.2-3102s21c1
Sequence:CCGGTTGAGACCTGGAGATCTAATTCTCGAGAATTAGATCTCCAGGTCTCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412975    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175861.2-1927s21c1
Sequence:CCGGGCTGAGCAGGAGCGGTTTAAACTCGAGTTTAAACCGCTCCTGCTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175861
TMTC1 MISSION shRNA Lentiviral Transduction Particles
transmembrane and tetratricopeptide repeat containing 1
Human
2 Products Total
TRC Number Volume Titer Vector Price Set Price (2)? Select
TRCN0000436579    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175861.2-3102s21c1
Sequence:CCGGTTGAGACCTGGAGATCTAATTCTCGAGAATTAGATCTCCAGGTCTCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412975    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175861.2-1927s21c1
Sequence:CCGGGCTGAGCAGGAGCGGTTTAAACTCGAGTTTAAACCGCTCCTGCTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_031920
VALIDATED
TMTC1 MISSION shRNA Bacterial Glycerol Stock
transmembrane and tetratricopeptide repeat containing 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000149558    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031920.2-758s1c1
Sequence:CCGGGCCAAGGTTCACTACAACTATCTCGAGATAGTTGTAGTGAACCTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147171    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_031920.2-1925s1c1
Sequence:CCGGCGATTACAAGAAGTTCGAGAACTCGAGTTCTCGAACTTCTTGTAATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148792    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031920.2-231s1c1
Sequence:CCGGCGCCTTACATTCTTACGAGATCTCGAGATCTCGTAAGAATGTAAGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149357    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031920.2-208s1c1
Sequence:CCGGGCAGGATAATCCAGCTTCATTCTCGAGAATGAAGCTGGATTATCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149375    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_031920.2-2375s1c1
Sequence:CCGGGAGGATAAATCCTCTGTGGTACTCGAGTACCACAGAGGATTTATCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129008    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_031920.2-1415s1c1
Sequence:CCGGGCTTTGCAGATTTACCAGGAACTCGAGTTCCTGGTAAATCTGCAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128746    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031920.2-1974s1c1
Sequence:CCGGCCCAACCTCATAGGATAATGTCTCGAGACATTATCCTATGAGGTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128306    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031920.2-2442s1c1
Sequence:CCGGGAACCAGGAATGAGTATCTAACTCGAGTTAGATACTCATTCCTGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_031920
VALIDATED
TMTC1 MISSION shRNA shRNA Plasmid DNA
transmembrane and tetratricopeptide repeat containing 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000149558    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031920.2-758s1c1
Sequence:CCGGGCCAAGGTTCACTACAACTATCTCGAGATAGTTGTAGTGAACCTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147171    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_031920.2-1925s1c1
Sequence:CCGGCGATTACAAGAAGTTCGAGAACTCGAGTTCTCGAACTTCTTGTAATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148792    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031920.2-231s1c1
Sequence:CCGGCGCCTTACATTCTTACGAGATCTCGAGATCTCGTAAGAATGTAAGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149357    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031920.2-208s1c1
Sequence:CCGGGCAGGATAATCCAGCTTCATTCTCGAGAATGAAGCTGGATTATCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149375    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_031920.2-2375s1c1
Sequence:CCGGGAGGATAAATCCTCTGTGGTACTCGAGTACCACAGAGGATTTATCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129008    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_031920.2-1415s1c1
Sequence:CCGGGCTTTGCAGATTTACCAGGAACTCGAGTTCCTGGTAAATCTGCAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128746    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031920.2-1974s1c1
Sequence:CCGGCCCAACCTCATAGGATAATGTCTCGAGACATTATCCTATGAGGTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128306    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031920.2-2442s1c1
Sequence:CCGGGAACCAGGAATGAGTATCTAACTCGAGTTAGATACTCATTCCTGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_031920
VALIDATED
TMTC1 MISSION shRNA Lentiviral Transduction Particles
transmembrane and tetratricopeptide repeat containing 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000149558    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031920.2-758s1c1
Sequence:CCGGGCCAAGGTTCACTACAACTATCTCGAGATAGTTGTAGTGAACCTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147171    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_031920.2-1925s1c1
Sequence:CCGGCGATTACAAGAAGTTCGAGAACTCGAGTTCTCGAACTTCTTGTAATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148792    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031920.2-231s1c1
Sequence:CCGGCGCCTTACATTCTTACGAGATCTCGAGATCTCGTAAGAATGTAAGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149357    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031920.2-208s1c1
Sequence:CCGGGCAGGATAATCCAGCTTCATTCTCGAGAATGAAGCTGGATTATCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149375    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_031920.2-2375s1c1
Sequence:CCGGGAGGATAAATCCTCTGTGGTACTCGAGTACCACAGAGGATTTATCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129008    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_031920.2-1415s1c1
Sequence:CCGGGCTTTGCAGATTTACCAGGAACTCGAGTTCCTGGTAAATCTGCAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128746    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031920.2-1974s1c1
Sequence:CCGGCCCAACCTCATAGGATAATGTCTCGAGACATTATCCTATGAGGTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128306    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031920.2-2442s1c1
Sequence:CCGGGAACCAGGAATGAGTATCTAACTCGAGTTAGATACTCATTCCTGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198967
TMTC1 MISSION shRNA Bacterial Glycerol Stock
transmembrane and tetratricopeptide repeat containing 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000201698    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198967.1-2412s1c1
Sequence:CCGGGTCAGACCAAAGAAGCTGAAACTCGAGTTTCAGCTTCTTTGGTCTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000201426    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198967.1-1264s1c1
Sequence:CCGGCCTTACAAGGTTCCTTACCTACTCGAGTAGGTAAGGAACCTTGTAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191778    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198967.1-1930s1c1
Sequence:CCGGGCTGAAGGAATCCATTAAATACTCGAGTATTTAATGGATTCCTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191331    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198967.1-3177s1c1
Sequence:CCGGCCAGAAATACAGAAACTCAAACTCGAGTTTGAGTTTCTGTATTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192782    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198967.1-3381s1c1
Sequence:CCGGCCAGATTATCACTAAGCACTTCTCGAGAAGTGCTTAGTGATAATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198967
TMTC1 MISSION shRNA shRNA Plasmid DNA
transmembrane and tetratricopeptide repeat containing 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000201698    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198967.1-2412s1c1
Sequence:CCGGGTCAGACCAAAGAAGCTGAAACTCGAGTTTCAGCTTCTTTGGTCTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000201426    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198967.1-1264s1c1
Sequence:CCGGCCTTACAAGGTTCCTTACCTACTCGAGTAGGTAAGGAACCTTGTAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191778    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198967.1-1930s1c1
Sequence:CCGGGCTGAAGGAATCCATTAAATACTCGAGTATTTAATGGATTCCTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191331    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198967.1-3177s1c1
Sequence:CCGGCCAGAAATACAGAAACTCAAACTCGAGTTTGAGTTTCTGTATTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192782    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198967.1-3381s1c1
Sequence:CCGGCCAGATTATCACTAAGCACTTCTCGAGAAGTGCTTAGTGATAATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198967
TMTC1 MISSION shRNA Lentiviral Transduction Particles
transmembrane and tetratricopeptide repeat containing 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000201698    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198967.1-2412s1c1
Sequence:CCGGGTCAGACCAAAGAAGCTGAAACTCGAGTTTCAGCTTCTTTGGTCTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000201426    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198967.1-1264s1c1
Sequence:CCGGCCTTACAAGGTTCCTTACCTACTCGAGTAGGTAAGGAACCTTGTAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191778    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198967.1-1930s1c1
Sequence:CCGGGCTGAAGGAATCCATTAAATACTCGAGTATTTAATGGATTCCTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191331    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198967.1-3177s1c1
Sequence:CCGGCCAGAAATACAGAAACTCAAACTCGAGTTTGAGTTTCTGTATTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192782    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198967.1-3381s1c1
Sequence:CCGGCCAGATTATCACTAAGCACTTCTCGAGAAGTGCTTAGTGATAATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks