EMAIL THIS PAGE TO A FRIEND

TMTC2

transmembrane and tetratricopeptide repeat containing 2

Synonyms: IBDBP1
UniProtKB ID: Q8N394, B2RCU7, Q8N2K8
Gene ID:
Mouse(278279) transmembrane and tetratricopeptide repeat containing 2
Rat(299762) transmembrane and tetratricopeptide repeat containing 2
cow(100337258) transmembrane and tetratricopeptide repeat containing 2
sheep(101106758) transmembrane and tetratricopeptide repeat containing 2
naked mole-rat(101721941) transmembrane and tetratricopeptide repeat containing 2
domestic guinea pig(100733060) transmembrane and tetratricopeptide repeat containing 2
Zebrafish(564667) transmembrane and tetratricopeptide repeat containing 2
Horse(100050838) transmembrane and tetratricopeptide repeat containing 2
domestic cat(101094358) transmembrane and tetratricopeptide repeat containing 2
chicken(417880) transmembrane and tetratricopeptide repeat containing 2
dog(482584) transmembrane and tetratricopeptide repeat containing 2
153 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152588 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152588 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152588 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_177368 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177368 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177368 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152588 Rosetta Predictions human pricing
XM_001080732 Rosetta Predictions rat pricing
XM_235136 Rosetta Predictions rat pricing
NM_177368 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152588 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00366423 predicted 2993
2 SASI_Hs01_00208741 predicted 2756
3 SASI_Hs02_00366424 predicted 1452
4 SASI_Hs01_00208743 predicted 1694
5 SASI_Hs02_00366425 predicted 1960
6 SASI_Hs01_00208746 predicted 2235
7 SASI_Hs01_00208747 predicted 2287
8 SASI_Hs02_00366426 predicted 2864
9 SASI_Hs01_00208749 predicted 1912
10 SASI_Hs02_00366427 predicted 775
11 SASI_Hs01_00208740 predicted 2570
12 SASI_Hs01_00208742 predicted 1932
13 SASI_Hs01_00208744 predicted 1973
14 SASI_Hs01_00208745 predicted 1756
15 SASI_Hs01_00208748 predicted 2575
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001080732 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00369110 predicted 1023
2 SASI_Rn02_00369111 predicted 2815
3 SASI_Rn02_00369112 predicted 937
4 SASI_Rn02_00369113 predicted 2908
5 SASI_Rn02_00369114 predicted 2462
6 SASI_Rn02_00369115 predicted 3199
7 SASI_Rn02_00369116 predicted 1519
8 SASI_Rn02_00369117 predicted 1525
9 SASI_Rn02_00369118 predicted 2167
10 SASI_Rn02_00369119 predicted 2746
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_235136 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00389015 predicted 507
2 SASI_Rn02_00389016 predicted 2412
3 SASI_Rn02_00389017 predicted 420
4 SASI_Rn02_00389018 predicted 2233
5 SASI_Rn02_00389019 predicted 1143
6 SASI_Rn02_00389020 predicted 994
7 SASI_Rn02_00389021 predicted 224
8 SASI_Rn02_00389022 predicted 1006
9 SASI_Rn02_00389023 predicted 2231
10 SASI_Rn02_00389024 predicted 2433
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177368 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00347525 predicted 2221
2 SASI_Mm01_00139919 predicted 2857
3 SASI_Mm01_00139920 predicted 2518
4 SASI_Mm01_00139922 predicted 2509
5 SASI_Mm01_00139923 predicted 2309
6 SASI_Mm01_00139924 predicted 2785
7 SASI_Mm01_00139925 predicted 1556
8 SASI_Mm01_00139926 predicted 1146
9 SASI_Mm01_00139927 predicted 1568
10 SASI_Mm01_00139928 predicted 2212
11 SASI_Mm01_00139921 predicted 2956
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152588
VALIDATED
TMTC2 MISSION shRNA Bacterial Glycerol Stock
transmembrane and tetratricopeptide repeat containing 2
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000168515    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_152588.1-4080s1c1
Sequence:CCGGGCTGCAATAGAGTGTAGCATTCTCGAGAATGCTACACTCTATTGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167927    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152588.1-1478s1c1
Sequence:CCGGCAAATGGACATAGCTGCCTTTCTCGAGAAAGGCAGCTATGTCCATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168311    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_152588.1-2416s1c1
Sequence:CCGGGCAGAGCATTGGTATATGGAACTCGAGTTCCATATACCAATGCTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172715    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_152588.1-1375s1c1
Sequence:CCGGGCCTTCTATACTGGACTCCTTCTCGAGAAGGAGTCCAGTATAGAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432748    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152588.1-3352s21c1
Sequence:CCGGGTGTTACGAGGGAGTGATAAACTCGAGTTTATCACTCCCTCGTAACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416613    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152588.1-1685s21c1
Sequence:CCGGTAATTGCAGAGCGAGTATTATCTCGAGATAATACTCGCTCTGCAATTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421685    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152588.1-2745s21c1
Sequence:CCGGAGCCAGGCTGAGGCCTAATTACTCGAGTAATTAGGCCTCAGCCTGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430634    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152588.1-1062s21c1
Sequence:CCGGACAGATATTACCTACCATTTACTCGAGTAAATGGTAGGTAATATCTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152588
VALIDATED
TMTC2 MISSION shRNA shRNA Plasmid DNA
transmembrane and tetratricopeptide repeat containing 2
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000168515    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_152588.1-4080s1c1
Sequence:CCGGGCTGCAATAGAGTGTAGCATTCTCGAGAATGCTACACTCTATTGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167927    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152588.1-1478s1c1
Sequence:CCGGCAAATGGACATAGCTGCCTTTCTCGAGAAAGGCAGCTATGTCCATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168311    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_152588.1-2416s1c1
Sequence:CCGGGCAGAGCATTGGTATATGGAACTCGAGTTCCATATACCAATGCTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172715    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_152588.1-1375s1c1
Sequence:CCGGGCCTTCTATACTGGACTCCTTCTCGAGAAGGAGTCCAGTATAGAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432748    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152588.1-3352s21c1
Sequence:CCGGGTGTTACGAGGGAGTGATAAACTCGAGTTTATCACTCCCTCGTAACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416613    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152588.1-1685s21c1
Sequence:CCGGTAATTGCAGAGCGAGTATTATCTCGAGATAATACTCGCTCTGCAATTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421685    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152588.1-2745s21c1
Sequence:CCGGAGCCAGGCTGAGGCCTAATTACTCGAGTAATTAGGCCTCAGCCTGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430634    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152588.1-1062s21c1
Sequence:CCGGACAGATATTACCTACCATTTACTCGAGTAAATGGTAGGTAATATCTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152588
VALIDATED
TMTC2 MISSION shRNA Lentiviral Transduction Particles
transmembrane and tetratricopeptide repeat containing 2
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000168515    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_152588.1-4080s1c1
Sequence:CCGGGCTGCAATAGAGTGTAGCATTCTCGAGAATGCTACACTCTATTGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167927    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152588.1-1478s1c1
Sequence:CCGGCAAATGGACATAGCTGCCTTTCTCGAGAAAGGCAGCTATGTCCATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168311    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_152588.1-2416s1c1
Sequence:CCGGGCAGAGCATTGGTATATGGAACTCGAGTTCCATATACCAATGCTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172715    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_152588.1-1375s1c1
Sequence:CCGGGCCTTCTATACTGGACTCCTTCTCGAGAAGGAGTCCAGTATAGAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432748    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152588.1-3352s21c1
Sequence:CCGGGTGTTACGAGGGAGTGATAAACTCGAGTTTATCACTCCCTCGTAACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416613    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152588.1-1685s21c1
Sequence:CCGGTAATTGCAGAGCGAGTATTATCTCGAGATAATACTCGCTCTGCAATTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421685    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152588.1-2745s21c1
Sequence:CCGGAGCCAGGCTGAGGCCTAATTACTCGAGTAATTAGGCCTCAGCCTGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430634    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152588.1-1062s21c1
Sequence:CCGGACAGATATTACCTACCATTTACTCGAGTAAATGGTAGGTAATATCTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177368
TMTC2 MISSION shRNA Bacterial Glycerol Stock
transmembrane and tetratricopeptide repeat containing 2
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000176179    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177368.2-2282s1c1
Sequence:CCGGGCTGACATGCTGTATAATCTACTCGAGTAGATTATACAGCATGTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173924    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177368.2-2576s1c1
Sequence:CCGGGCCCTGAGTGTATATAGGGAACTCGAGTTCCCTATATACACTCAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175964    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177368.2-1164s1c1
Sequence:CCGGGCTACATTAAGCACTGTTCTACTCGAGTAGAACAGTGCTTAATGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216959    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_177368.4-4456s1c1
Sequence:CCGGCTCACCTCCTATTAGCTATTTCTCGAGAAATAGCTAATAGGAGGTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249556    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177368.4-2099s21c1
Sequence:CCGGTATGCTACTGCCACGTTAATTCTCGAGAATTAACGTGGCAGTAGCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249555    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177368.4-1307s21c1
Sequence:CCGGCTGGCAGTTTCAGCCGTTTATCTCGAGATAAACGGCTGAAACTGCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249554    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177368.4-4468s21c1
Sequence:CCGGTAGCTATTTCAGTGATCATTTCTCGAGAAATGATCACTGAAATAGCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257918    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177368.4-1983s21c1
Sequence:CCGGTAATCGCAGAGCGAGTCTTATCTCGAGATAAGACTCGCTCTGCGATTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257915    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177368.4-3043s21c1
Sequence:CCGGAGCAAGACTGAGACCTAATTACTCGAGTAATTAGGTCTCAGTCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177368
TMTC2 MISSION shRNA shRNA Plasmid DNA
transmembrane and tetratricopeptide repeat containing 2
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000176179    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177368.2-2282s1c1
Sequence:CCGGGCTGACATGCTGTATAATCTACTCGAGTAGATTATACAGCATGTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173924    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177368.2-2576s1c1
Sequence:CCGGGCCCTGAGTGTATATAGGGAACTCGAGTTCCCTATATACACTCAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175964    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177368.2-1164s1c1
Sequence:CCGGGCTACATTAAGCACTGTTCTACTCGAGTAGAACAGTGCTTAATGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216959    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_177368.4-4456s1c1
Sequence:CCGGCTCACCTCCTATTAGCTATTTCTCGAGAAATAGCTAATAGGAGGTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249556    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177368.4-2099s21c1
Sequence:CCGGTATGCTACTGCCACGTTAATTCTCGAGAATTAACGTGGCAGTAGCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249555    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177368.4-1307s21c1
Sequence:CCGGCTGGCAGTTTCAGCCGTTTATCTCGAGATAAACGGCTGAAACTGCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249554    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177368.4-4468s21c1
Sequence:CCGGTAGCTATTTCAGTGATCATTTCTCGAGAAATGATCACTGAAATAGCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257918    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177368.4-1983s21c1
Sequence:CCGGTAATCGCAGAGCGAGTCTTATCTCGAGATAAGACTCGCTCTGCGATTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257915    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177368.4-3043s21c1
Sequence:CCGGAGCAAGACTGAGACCTAATTACTCGAGTAATTAGGTCTCAGTCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177368
TMTC2 MISSION shRNA Lentiviral Transduction Particles
transmembrane and tetratricopeptide repeat containing 2
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000176179    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177368.2-2282s1c1
Sequence:CCGGGCTGACATGCTGTATAATCTACTCGAGTAGATTATACAGCATGTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173924    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177368.2-2576s1c1
Sequence:CCGGGCCCTGAGTGTATATAGGGAACTCGAGTTCCCTATATACACTCAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175964    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177368.2-1164s1c1
Sequence:CCGGGCTACATTAAGCACTGTTCTACTCGAGTAGAACAGTGCTTAATGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216959    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_177368.4-4456s1c1
Sequence:CCGGCTCACCTCCTATTAGCTATTTCTCGAGAAATAGCTAATAGGAGGTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249556    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177368.4-2099s21c1
Sequence:CCGGTATGCTACTGCCACGTTAATTCTCGAGAATTAACGTGGCAGTAGCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249555    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177368.4-1307s21c1
Sequence:CCGGCTGGCAGTTTCAGCCGTTTATCTCGAGATAAACGGCTGAAACTGCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249554    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177368.4-4468s21c1
Sequence:CCGGTAGCTATTTCAGTGATCATTTCTCGAGAAATGATCACTGAAATAGCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257918    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177368.4-1983s21c1
Sequence:CCGGTAATCGCAGAGCGAGTCTTATCTCGAGATAAGACTCGCTCTGCGATTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257915    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177368.4-3043s21c1
Sequence:CCGGAGCAAGACTGAGACCTAATTACTCGAGTAATTAGGTCTCAGTCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks