EMAIL THIS PAGE TO A FRIEND

TMTC3

transmembrane and tetratricopeptide repeat containing 3

Synonyms: SMILE
Gene ID:
Human(160418) Summary: This gene encodes a protein that belongs to the transmembrane and tetratricopeptide repeat-containing protein family. [provided by RefSeq, May 2010]
Mouse(237500) transmembrane and tetratricopeptide repeat containing 3
Rat(314785) transmembrane and tetratricopeptide repeat containing 3
Zebrafish(100150181) transmembrane and tetratricopeptide repeat containing 3
Horse(100051353) transmembrane and tetratricopeptide repeat containing 3
domestic cat(101099734) transmembrane and tetratricopeptide repeat containing 3
dog(475421) transmembrane and tetratricopeptide repeat containing 3
chicken(417888) transmembrane and tetratricopeptide repeat containing 3
domestic guinea pig(100722567) transmembrane and tetratricopeptide repeat containing 3
naked mole-rat(101696722) transmembrane and tetratricopeptide repeat containing 3
Domestic Rabbit(100355191) transmembrane and tetratricopeptide repeat containing 3
cow(522132) transmembrane and tetratricopeptide repeat containing 3
sheep(101109785) transmembrane and tetratricopeptide repeat containing 3
81 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001033332 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001033332 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001033332 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_181783 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_181783 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_181783 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_181783 Rosetta Predictions human pricing
XM_001080635 Rosetta Predictions rat pricing
XM_235093 Rosetta Predictions rat pricing
NM_001033332 Rosetta Predictions mouse pricing
NM_001110013 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181783 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00139323 predicted 2385
2 SASI_Hs01_00139324 predicted 2183
3 SASI_Hs01_00139326 predicted 1018
4 SASI_Hs01_00139327 predicted 237
5 SASI_Hs01_00139328 predicted 1618
6 SASI_Hs01_00139329 predicted 2270
7 SASI_Hs01_00139330 predicted 974
8 SASI_Hs01_00139332 predicted 1869
9 SASI_Hs02_00370384 predicted 1630
10 SASI_Hs02_00370385 predicted 2372
11 SASI_Hs01_00139325 predicted 1777
12 SASI_Hs01_00139331 predicted 2283
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001080635 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00368750 predicted 2486
2 SASI_Rn02_00368751 predicted 1604
3 SASI_Rn02_00368752 predicted 1977
4 SASI_Rn02_00368753 predicted 2370
5 SASI_Rn02_00368754 predicted 2913
6 SASI_Rn02_00368755 predicted 383
7 SASI_Rn02_00368756 predicted 2233
8 SASI_Rn02_00368757 predicted 1890
9 SASI_Rn02_00368758 predicted 728
10 SASI_Rn02_00368759 predicted 993
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_235093 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00388975 predicted 2488
2 SASI_Rn02_00388976 predicted 1602
3 SASI_Rn02_00388977 predicted 1977
4 SASI_Rn02_00388978 predicted 2366
5 SASI_Rn02_00388979 predicted 921
6 SASI_Rn02_00388980 predicted 386
7 SASI_Rn02_00388981 predicted 371
8 SASI_Rn02_00388982 predicted 2233
9 SASI_Rn02_00388983 predicted 1897
10 SASI_Rn02_00388984 predicted 719
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033332 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00288579 predicted 1255
2 SASI_Mm01_00090906 predicted 1710
3 SASI_Mm02_00288580 predicted 1431
4 SASI_Mm01_00090908 predicted 1133
5 SASI_Mm01_00090911 predicted 988
6 SASI_Mm02_00288581 predicted 449
7 SASI_Mm01_00090912 predicted 783
8 SASI_Mm01_00090913 predicted 1148
9 SASI_Mm01_00090915 predicted 236
10 SASI_Mm02_00288582 predicted 815
11 SASI_Mm01_00090907 predicted 2102
12 SASI_Mm01_00090909 predicted 2021
13 SASI_Mm01_00090910 predicted 2173
14 SASI_Mm01_00090914 predicted 2093
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001110013 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00304584 predicted 1252
2 SASI_Mm02_00304585 predicted 1711
3 SASI_Mm02_00304586 predicted 1431
4 SASI_Mm02_00304587 predicted 1133
5 SASI_Mm02_00304588 predicted 987
6 SASI_Mm02_00304589 predicted 444
7 SASI_Mm02_00304590 predicted 786
8 SASI_Mm02_00304591 predicted 1148
9 SASI_Mm02_00304592 predicted 227
10 SASI_Mm02_00304593 predicted 816
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001033332
VALIDATED
TMTC3 MISSION shRNA Bacterial Glycerol Stock
transmembrane and tetratricopeptide repeat containing 3
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000178062    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001033332.1-1267s1c1
Sequence:CCGGGCGCTTTGTTTAATGGCGTTACTCGAGTAACGCCATTAAACAAAGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177816    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001033332.1-732s1c1
Sequence:CCGGCCCGATTGTATTAACCGTGTTCTCGAGAACACGGTTAATACAATCGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177271    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001033332.1-2113s1c1
Sequence:CCGGGCACTGTTCAATTCTGCTATTCTCGAGAATAGCAGAATTGAACAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197669    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001033332.1-2533s1c1
Sequence:CCGGCATGTTAGTTTACTGTGACTTCTCGAGAAGTCACAGTAAACTAACATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001033332
VALIDATED
TMTC3 MISSION shRNA shRNA Plasmid DNA
transmembrane and tetratricopeptide repeat containing 3
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000178062    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001033332.1-1267s1c1
Sequence:CCGGGCGCTTTGTTTAATGGCGTTACTCGAGTAACGCCATTAAACAAAGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177816    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001033332.1-732s1c1
Sequence:CCGGCCCGATTGTATTAACCGTGTTCTCGAGAACACGGTTAATACAATCGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177271    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001033332.1-2113s1c1
Sequence:CCGGGCACTGTTCAATTCTGCTATTCTCGAGAATAGCAGAATTGAACAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197669    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001033332.1-2533s1c1
Sequence:CCGGCATGTTAGTTTACTGTGACTTCTCGAGAAGTCACAGTAAACTAACATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001033332
VALIDATED
TMTC3 MISSION shRNA Lentiviral Transduction Particles
transmembrane and tetratricopeptide repeat containing 3
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000178062    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001033332.1-1267s1c1
Sequence:CCGGGCGCTTTGTTTAATGGCGTTACTCGAGTAACGCCATTAAACAAAGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177816    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001033332.1-732s1c1
Sequence:CCGGCCCGATTGTATTAACCGTGTTCTCGAGAACACGGTTAATACAATCGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177271    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001033332.1-2113s1c1
Sequence:CCGGGCACTGTTCAATTCTGCTATTCTCGAGAATAGCAGAATTGAACAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197669    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001033332.1-2533s1c1
Sequence:CCGGCATGTTAGTTTACTGTGACTTCTCGAGAAGTCACAGTAAACTAACATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_181783
TMTC3 MISSION shRNA Bacterial Glycerol Stock
transmembrane and tetratricopeptide repeat containing 3
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000138331    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181783.1-2290s1c1
Sequence:CCGGCGACTTCCGAAGTGCTTTGTTCTCGAGAACAAAGCACTTCGGAAGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137638    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181783.1-1796s1c1
Sequence:CCGGGCTAACCTGATCCGAGCAAATCTCGAGATTTGCTCGGATCAGGTTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137021    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181783.1-1623s1c1
Sequence:CCGGCAGATGATATTGGTGCCCATACTCGAGTATGGGCACCAATATCATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136826    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181783.1-710s1c1
Sequence:CCGGCCAATTGCCTTGACAGTGTTTCTCGAGAAACACTGTCAAGGCAATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136904    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_181783.1-4530s1c1
Sequence:CCGGCCTAAGGATCTGCCATAGATTCTCGAGAATCTATGGCAGATCCTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000133967    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181783.1-1967s1c1
Sequence:CCGGCTGGACAGAAATAATGCAGATCTCGAGATCTGCATTATTTCTGTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137372    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_181783.1-4501s1c1
Sequence:CCGGGCATTAGAAGACCCACTCTTACTCGAGTAAGAGTGGGTCTTCTAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138196    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181783.1-392s1c1
Sequence:CCGGCACAAGTCTTACCGTCCCTTACTCGAGTAAGGGACGGTAAGACTTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138232    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181783.1-1622s1c1
Sequence:CCGGCCAGATGATATTGGTGCCCATCTCGAGATGGGCACCAATATCATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_181783
TMTC3 MISSION shRNA shRNA Plasmid DNA
transmembrane and tetratricopeptide repeat containing 3
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000138331    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181783.1-2290s1c1
Sequence:CCGGCGACTTCCGAAGTGCTTTGTTCTCGAGAACAAAGCACTTCGGAAGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137638    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181783.1-1796s1c1
Sequence:CCGGGCTAACCTGATCCGAGCAAATCTCGAGATTTGCTCGGATCAGGTTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137021    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181783.1-1623s1c1
Sequence:CCGGCAGATGATATTGGTGCCCATACTCGAGTATGGGCACCAATATCATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136826    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181783.1-710s1c1
Sequence:CCGGCCAATTGCCTTGACAGTGTTTCTCGAGAAACACTGTCAAGGCAATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136904    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_181783.1-4530s1c1
Sequence:CCGGCCTAAGGATCTGCCATAGATTCTCGAGAATCTATGGCAGATCCTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000133967    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181783.1-1967s1c1
Sequence:CCGGCTGGACAGAAATAATGCAGATCTCGAGATCTGCATTATTTCTGTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137372    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_181783.1-4501s1c1
Sequence:CCGGGCATTAGAAGACCCACTCTTACTCGAGTAAGAGTGGGTCTTCTAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138196    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181783.1-392s1c1
Sequence:CCGGCACAAGTCTTACCGTCCCTTACTCGAGTAAGGGACGGTAAGACTTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138232    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181783.1-1622s1c1
Sequence:CCGGCCAGATGATATTGGTGCCCATCTCGAGATGGGCACCAATATCATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_181783
TMTC3 MISSION shRNA Lentiviral Transduction Particles
transmembrane and tetratricopeptide repeat containing 3
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000138331    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181783.1-2290s1c1
Sequence:CCGGCGACTTCCGAAGTGCTTTGTTCTCGAGAACAAAGCACTTCGGAAGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137638    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181783.1-1796s1c1
Sequence:CCGGGCTAACCTGATCCGAGCAAATCTCGAGATTTGCTCGGATCAGGTTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137021    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181783.1-1623s1c1
Sequence:CCGGCAGATGATATTGGTGCCCATACTCGAGTATGGGCACCAATATCATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136826    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181783.1-710s1c1
Sequence:CCGGCCAATTGCCTTGACAGTGTTTCTCGAGAAACACTGTCAAGGCAATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136904    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_181783.1-4530s1c1
Sequence:CCGGCCTAAGGATCTGCCATAGATTCTCGAGAATCTATGGCAGATCCTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000133967    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181783.1-1967s1c1
Sequence:CCGGCTGGACAGAAATAATGCAGATCTCGAGATCTGCATTATTTCTGTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137372    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_181783.1-4501s1c1
Sequence:CCGGGCATTAGAAGACCCACTCTTACTCGAGTAAGAGTGGGTCTTCTAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138196    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181783.1-392s1c1
Sequence:CCGGCACAAGTCTTACCGTCCCTTACTCGAGTAAGGGACGGTAAGACTTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138232    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181783.1-1622s1c1
Sequence:CCGGCCAGATGATATTGGTGCCCATCTCGAGATGGGCACCAATATCATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks