EMAIL THIS PAGE TO A FRIEND

TMTC4

transmembrane and tetratricopeptide repeat containing 4

Gene ID:
Mouse(70551) transmembrane and tetratricopeptide repeat containing 4
Rat(290501) transmembrane and tetratricopeptide repeat containing 4
cow(539972) transmembrane and tetratricopeptide repeat containing 4
sheep(101112235) transmembrane and tetratricopeptide repeat containing 4
Domestic Rabbit(100358355) transmembrane and tetratricopeptide repeat containing 4
naked mole-rat(101704747) transmembrane and tetratricopeptide repeat containing 4
domestic guinea pig(100722385) transmembrane and tetratricopeptide repeat containing 4
Zebrafish(560605) transmembrane and tetratricopeptide repeat containing 4
dog(476977) transmembrane and tetratricopeptide repeat containing 4
domestic cat(101081355) transmembrane and tetratricopeptide repeat containing 4
chicken(418772) transmembrane and tetratricopeptide repeat containing 4
99 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2102486 Anti-TMTC4 (ab1) antibody produced in rabbit affinity isolated antibody bovine, horse, zebrafish, guinea pig, human, mouse, rat, rabbit
western blot pricing
SAB2102487 Anti-TMTC4 (ab2) antibody produced in rabbit affinity isolated antibody mouse, human, horse, rabbit, zebrafish, rat, guinea pig
western blot pricing
HPA016489 Anti-TMTC4 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032813 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032813 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032813 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_028651 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028651 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028651 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001079669 Rosetta Predictions human pricing
NM_032813 Rosetta Predictions human pricing
NM_001134414 Rosetta Predictions rat pricing
NM_028651 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001079669 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00313630 predicted 1674
2 SASI_Hs02_00313631 predicted 2014
3 SASI_Hs02_00313632 predicted 1901
4 SASI_Hs02_00313633 predicted 1628
5 SASI_Hs02_00313634 predicted 2255
6 SASI_Hs02_00313635 predicted 2038
7 SASI_Hs02_00313636 predicted 2026
8 SASI_Hs02_00313637 predicted 2226
9 SASI_Hs02_00313638 predicted 2088
10 SASI_Hs02_00313639 predicted 862
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032813 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00360386 predicted 1889
2 SASI_Hs01_00170564 predicted 2227
3 SASI_Hs02_00360387 predicted 2111
4 SASI_Hs02_00360388 predicted 1840
5 SASI_Hs01_00170568 predicted 2467
6 SASI_Hs01_00170569 predicted 2251
7 SASI_Hs01_00170570 predicted 2232
8 SASI_Hs01_00170571 predicted 2433
9 SASI_Hs01_00170572 predicted 2296
10 SASI_Hs02_00360389 predicted 1066
11 SASI_Hs01_00170563 predicted 1506
12 SASI_Hs01_00170565 predicted 1069
13 SASI_Hs01_00170566 predicted 849
14 SASI_Hs01_00170567 predicted 1531
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001134414 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00256269 predicted 732
2 SASI_Rn02_00256270 predicted 793
3 SASI_Rn02_00256271 predicted 1638
4 SASI_Rn02_00256272 predicted 246
5 SASI_Rn02_00256273 predicted 1616
6 SASI_Rn02_00256274 predicted 2041
7 SASI_Rn02_00256275 predicted 1173
8 SASI_Rn02_00256276 predicted 1202
9 SASI_Rn02_00256277 predicted 1832
10 SASI_Rn02_00256278 predicted 1969
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028651 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00137384 predicted 1290
2 SASI_Mm01_00137385 predicted 754
3 SASI_Mm02_00334169 predicted 1694
4 SASI_Mm01_00137386 predicted 2080
5 SASI_Mm01_00137388 predicted 2311
6 SASI_Mm01_00137389 predicted 1226
7 SASI_Mm01_00137390 predicted 1533
8 SASI_Mm01_00137391 predicted 915
9 SASI_Mm01_00137392 predicted 1196
10 SASI_Mm01_00137393 predicted 1738
11 SASI_Mm01_00137387 predicted 286
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032813
VALIDATED
TMTC4 MISSION shRNA Bacterial Glycerol Stock
transmembrane and tetratricopeptide repeat containing 4
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000153751    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032813.1-1113s1c1
Sequence:CCGGCGTCTGTATGCAGATCTCAATCTCGAGATTGAGATCTGCATACAGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152485    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032813.1-632s1c1
Sequence:CCGGCCTGAGCAAACATACCAAGAACTCGAGTTCTTGGTATGTTTGCTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151284    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_032813.1-1524s1c1
Sequence:CCGGCTGAGAAGAAAGCTAGAACTACTCGAGTAGTTCTAGCTTTCTTCTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151358    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_032813.1-783s1c1
Sequence:CCGGGCTAAGGTTCACTACAACATTCTCGAGAATGTTGTAGTGAACCTTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151438    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032813.1-1356s1c1
Sequence:CCGGGCTTTATTCCTCAAGGCAATTCTCGAGAATTGCCTTGAGGAATAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151556    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_032813.1-2208s1c1
Sequence:CCGGGCAATTTCAATACACAGGAGACTCGAGTCTCCTGTGTATTGAAATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151611    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_032813.1-677s1c1
Sequence:CCGGGCTGGGAATCTTATTCATCAACTCGAGTTGATGAATAAGATTCCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152153    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_032813.1-2197s1c1
Sequence:CCGGCTCTGACTTGTGCAATTTCAACTCGAGTTGAAATTGCACAAGTCAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152152    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_032813.1-1335s1c1
Sequence:CCGGCAGGAATACAAGGAATCTGAACTCGAGTTCAGATTCCTTGTATTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152346    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_032813.1-1715s1c1
Sequence:CCGGCACCAGCAATATACTCTTGAACTCGAGTTCAAGAGTATATTGCTGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032813
VALIDATED
TMTC4 MISSION shRNA shRNA Plasmid DNA
transmembrane and tetratricopeptide repeat containing 4
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000153751    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032813.1-1113s1c1
Sequence:CCGGCGTCTGTATGCAGATCTCAATCTCGAGATTGAGATCTGCATACAGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152485    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032813.1-632s1c1
Sequence:CCGGCCTGAGCAAACATACCAAGAACTCGAGTTCTTGGTATGTTTGCTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151284    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_032813.1-1524s1c1
Sequence:CCGGCTGAGAAGAAAGCTAGAACTACTCGAGTAGTTCTAGCTTTCTTCTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151358    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_032813.1-783s1c1
Sequence:CCGGGCTAAGGTTCACTACAACATTCTCGAGAATGTTGTAGTGAACCTTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151438    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032813.1-1356s1c1
Sequence:CCGGGCTTTATTCCTCAAGGCAATTCTCGAGAATTGCCTTGAGGAATAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151556    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_032813.1-2208s1c1
Sequence:CCGGGCAATTTCAATACACAGGAGACTCGAGTCTCCTGTGTATTGAAATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151611    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_032813.1-677s1c1
Sequence:CCGGGCTGGGAATCTTATTCATCAACTCGAGTTGATGAATAAGATTCCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152153    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_032813.1-2197s1c1
Sequence:CCGGCTCTGACTTGTGCAATTTCAACTCGAGTTGAAATTGCACAAGTCAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152152    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_032813.1-1335s1c1
Sequence:CCGGCAGGAATACAAGGAATCTGAACTCGAGTTCAGATTCCTTGTATTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152346    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_032813.1-1715s1c1
Sequence:CCGGCACCAGCAATATACTCTTGAACTCGAGTTCAAGAGTATATTGCTGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032813
VALIDATED
TMTC4 MISSION shRNA Lentiviral Transduction Particles
transmembrane and tetratricopeptide repeat containing 4
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000153751    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032813.1-1113s1c1
Sequence:CCGGCGTCTGTATGCAGATCTCAATCTCGAGATTGAGATCTGCATACAGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152485    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032813.1-632s1c1
Sequence:CCGGCCTGAGCAAACATACCAAGAACTCGAGTTCTTGGTATGTTTGCTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151284    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_032813.1-1524s1c1
Sequence:CCGGCTGAGAAGAAAGCTAGAACTACTCGAGTAGTTCTAGCTTTCTTCTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151358    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_032813.1-783s1c1
Sequence:CCGGGCTAAGGTTCACTACAACATTCTCGAGAATGTTGTAGTGAACCTTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151438    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032813.1-1356s1c1
Sequence:CCGGGCTTTATTCCTCAAGGCAATTCTCGAGAATTGCCTTGAGGAATAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151556    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_032813.1-2208s1c1
Sequence:CCGGGCAATTTCAATACACAGGAGACTCGAGTCTCCTGTGTATTGAAATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151611    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_032813.1-677s1c1
Sequence:CCGGGCTGGGAATCTTATTCATCAACTCGAGTTGATGAATAAGATTCCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152153    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_032813.1-2197s1c1
Sequence:CCGGCTCTGACTTGTGCAATTTCAACTCGAGTTGAAATTGCACAAGTCAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152152    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_032813.1-1335s1c1
Sequence:CCGGCAGGAATACAAGGAATCTGAACTCGAGTTCAGATTCCTTGTATTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152346    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_032813.1-1715s1c1
Sequence:CCGGCACCAGCAATATACTCTTGAACTCGAGTTCAAGAGTATATTGCTGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028651
VALIDATED
TMTC4 MISSION shRNA Bacterial Glycerol Stock
transmembrane and tetratricopeptide repeat containing 4
Mouse
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000198966    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028651.1-1871s1c1
Sequence:CCGGGCGATTAAACACAGGAGGAAACTCGAGTTTCCTCCTGTGTTTAATCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198394    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_028651.1-3010s1c1
Sequence:CCGGGCAGGATAATATTCCACTGTTCTCGAGAACAGTGGAATATTATCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198290    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028651.1-206s1c1
Sequence:CCGGGCTAAGTTAGTAGTGGGATTTCTCGAGAAATCCCACTACTAACTTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182467    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028651.1-1697s1c1
Sequence:CCGGGCCATGAATAACCTCGGGAATCTCGAGATTCCCGAGGTTATTCATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178703    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028651.1-409s1c1
Sequence:CCGGCCTGACTTTCAGGATTAACTACTCGAGTAGTTAATCCTGAAAGTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177772    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028651.1-2104s1c1
Sequence:CCGGCCTTATGTTCTCATTGGCAAACTCGAGTTTGCCAATGAGAACATAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178142    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028651.1-2820s1c1
Sequence:CCGGGCAACAGTGTAACTTGAAGTTCTCGAGAACTTCAAGTTACACTGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000293092    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028651.2-2819s21c1
Sequence:CCGGGCAACAGTGTAACTTGAAGTTCTCGAGAACTTCAAGTTACACTGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216948    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028651.2-2003s1c1
Sequence:CCGGCGTGGAACAACATGATCATACCTCGAGGTATGATCATGTTGTTCCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000293093    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028651.2-2103s21c1
Sequence:CCGGCCTTATGTTCTCATTGGCAAACTCGAGTTTGCCAATGAGAACATAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000293094    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028651.2-1696s21c1
Sequence:CCGGGCCATGAATAACCTCGGGAATCTCGAGATTCCCGAGGTTATTCATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000293095    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028651.2-408s21c1
Sequence:CCGGCCTGACTTTCAGGATTAACTACTCGAGTAGTTAATCCTGAAAGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028651
VALIDATED
TMTC4 MISSION shRNA shRNA Plasmid DNA
transmembrane and tetratricopeptide repeat containing 4
Mouse
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000198966    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028651.1-1871s1c1
Sequence:CCGGGCGATTAAACACAGGAGGAAACTCGAGTTTCCTCCTGTGTTTAATCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198394    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_028651.1-3010s1c1
Sequence:CCGGGCAGGATAATATTCCACTGTTCTCGAGAACAGTGGAATATTATCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198290    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028651.1-206s1c1
Sequence:CCGGGCTAAGTTAGTAGTGGGATTTCTCGAGAAATCCCACTACTAACTTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182467    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028651.1-1697s1c1
Sequence:CCGGGCCATGAATAACCTCGGGAATCTCGAGATTCCCGAGGTTATTCATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178703    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028651.1-409s1c1
Sequence:CCGGCCTGACTTTCAGGATTAACTACTCGAGTAGTTAATCCTGAAAGTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177772    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028651.1-2104s1c1
Sequence:CCGGCCTTATGTTCTCATTGGCAAACTCGAGTTTGCCAATGAGAACATAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178142    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028651.1-2820s1c1
Sequence:CCGGGCAACAGTGTAACTTGAAGTTCTCGAGAACTTCAAGTTACACTGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000293092    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028651.2-2819s21c1
Sequence:CCGGGCAACAGTGTAACTTGAAGTTCTCGAGAACTTCAAGTTACACTGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216948    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028651.2-2003s1c1
Sequence:CCGGCGTGGAACAACATGATCATACCTCGAGGTATGATCATGTTGTTCCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000293093    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028651.2-2103s21c1
Sequence:CCGGCCTTATGTTCTCATTGGCAAACTCGAGTTTGCCAATGAGAACATAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000293094    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028651.2-1696s21c1
Sequence:CCGGGCCATGAATAACCTCGGGAATCTCGAGATTCCCGAGGTTATTCATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000293095    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028651.2-408s21c1
Sequence:CCGGCCTGACTTTCAGGATTAACTACTCGAGTAGTTAATCCTGAAAGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028651
VALIDATED
TMTC4 MISSION shRNA Lentiviral Transduction Particles
transmembrane and tetratricopeptide repeat containing 4
Mouse
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000198966    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028651.1-1871s1c1
Sequence:CCGGGCGATTAAACACAGGAGGAAACTCGAGTTTCCTCCTGTGTTTAATCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198394    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_028651.1-3010s1c1
Sequence:CCGGGCAGGATAATATTCCACTGTTCTCGAGAACAGTGGAATATTATCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198290    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028651.1-206s1c1
Sequence:CCGGGCTAAGTTAGTAGTGGGATTTCTCGAGAAATCCCACTACTAACTTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182467    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028651.1-1697s1c1
Sequence:CCGGGCCATGAATAACCTCGGGAATCTCGAGATTCCCGAGGTTATTCATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178703    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028651.1-409s1c1
Sequence:CCGGCCTGACTTTCAGGATTAACTACTCGAGTAGTTAATCCTGAAAGTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177772    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028651.1-2104s1c1
Sequence:CCGGCCTTATGTTCTCATTGGCAAACTCGAGTTTGCCAATGAGAACATAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178142    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028651.1-2820s1c1
Sequence:CCGGGCAACAGTGTAACTTGAAGTTCTCGAGAACTTCAAGTTACACTGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000293092    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028651.2-2819s21c1
Sequence:CCGGGCAACAGTGTAACTTGAAGTTCTCGAGAACTTCAAGTTACACTGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216948    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028651.2-2003s1c1
Sequence:CCGGCGTGGAACAACATGATCATACCTCGAGGTATGATCATGTTGTTCCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000293093    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028651.2-2103s21c1
Sequence:CCGGCCTTATGTTCTCATTGGCAAACTCGAGTTTGCCAATGAGAACATAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000293094    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028651.2-1696s21c1
Sequence:CCGGGCCATGAATAACCTCGGGAATCTCGAGATTCCCGAGGTTATTCATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000293095    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028651.2-408s21c1
Sequence:CCGGCCTGACTTTCAGGATTAACTACTCGAGTAGTTAATCCTGAAAGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks