EMAIL THIS PAGE TO A FRIEND

TMUB1

transmembrane and ubiquitin-like domain containing 1

Synonyms: C7orf21 DULP
UniProtKB ID: Q9BVT8, D3DX06, Q53AQ2
Gene ID:
Mouse(64295) transmembrane and ubiquitin-like domain containing 1
Rat(362301) transmembrane and ubiquitin-like domain containing 1
cow(539388) transmembrane and ubiquitin-like domain containing 1
sheep(101103560) transmembrane and ubiquitin-like domain containing 1
domestic guinea pig(100713284) transmembrane and ubiquitin-like domain containing 1
naked mole-rat(101707291) transmembrane and ubiquitin-like domain containing 1
Zebrafish(406589) transmembrane and ubiquitin-like domain containing 1
chicken(431107) transmembrane and ubiquitin-like domain containing 1
dog(610957) transmembrane and ubiquitin-like domain containing 1
domestic cat(101098046) transmembrane and ubiquitin-like domain containing 1
93 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_031434 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_031434 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_031434 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_022418 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_022418 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_022418 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU016661 MISSION® esiRNA esiRNA targeting mouse Tmub1 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_031434 Rosetta Predictions human pricing
NM_001080153 Rosetta Predictions rat pricing
NM_198781 Rosetta Predictions rat pricing
NM_022418 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031434 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00207151 predicted 631
2 SASI_Hs01_00207152 predicted 569
3 SASI_Hs01_00207153 predicted 476
4 SASI_Hs01_00207154 predicted 337
5 SASI_Hs01_00207155 predicted 426
6 SASI_Hs01_00207157 predicted 335
7 SASI_Hs01_00207158 predicted 567
8 SASI_Hs01_00207159 predicted 435
9 SASI_Hs01_00207160 predicted 634
10 SASI_Hs02_00358845 predicted 629
11 SASI_Hs01_00207156 predicted 493
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001080153 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00208449 predicted 471
2 SASI_Rn02_00208450 predicted 987
3 SASI_Rn02_00208451 predicted 898
4 SASI_Rn02_00208452 predicted 335
5 SASI_Rn02_00208453 predicted 598
6 SASI_Rn02_00208454 predicted 558
7 SASI_Rn02_00208455 predicted 658
8 SASI_Rn02_00208456 predicted 1052
9 SASI_Rn02_00208457 predicted 458
10 SASI_Rn02_00208458 predicted 481
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198781 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00070956 predicted 380
2 SASI_Rn02_00270044 predicted 897
3 SASI_Rn01_00070957 predicted 810
4 SASI_Rn01_00070958 predicted 252
5 SASI_Rn01_00070959 predicted 513
6 SASI_Rn01_00070960 predicted 465
7 SASI_Rn01_00070961 predicted 574
8 SASI_Rn01_00070962 predicted 957
9 SASI_Rn02_00270045 predicted 366
10 SASI_Rn01_00070963 predicted 391
11 SASI_Rn01_00070964 predicted 431
12 SASI_Rn01_00070965 predicted 491
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022418 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00076262 predicted 944
2 SASI_Mm01_00076263 predicted 1025
3 SASI_Mm01_00076264 predicted 554
4 SASI_Mm01_00076265 predicted 852
5 SASI_Mm01_00076271 predicted 1001
6 SASI_Mm01_00076266 predicted 692
7 SASI_Mm01_00076267 predicted 540
8 SASI_Mm01_00076268 predicted 533
9 SASI_Mm01_00076269 predicted 573
10 SASI_Mm01_00076270 predicted 336
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_031434
VALIDATED
TMUB1 MISSION shRNA Bacterial Glycerol Stock
transmembrane and ubiquitin-like domain containing 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000428248    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031434.3-814s21c1
Sequence:CCGGTGAGACACAGAGGTCAAGCTGCTCGAGCAGCTTGACCTCTGTGTCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421048    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031434.3-1002s21c1
Sequence:CCGGGAACAGCAGGTGCGACTCATCCTCGAGGATGAGTCGCACCTGCTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422691    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031434.3-1305s21c1
Sequence:CCGGCTCCTGGCCTTTGCCATGTACCTCGAGGTACATGGCAAAGGCCAGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427486    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031434.3-917s21c1
Sequence:CCGGATTCCTCAATGATTCAGAGCACTCGAGTGCTCTGAATCATTGAGGAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073105    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_031434.2-573s1c1
Sequence:CCGGCCCTCGTGCTACGGCTGAAATCTCGAGATTTCAGCCGTAGCACGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073103    
Product Details
Validated
Region:UNK Mean KnockDown Level: 0.82 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_031434.2-1438s1c1
Sequence:CCGGGAACCCGTGCAGATTAAAGTACTCGAGTACTTTAATCTGCACGGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073104    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_031434.2-581s1c1
Sequence:CCGGCTACGGCTGAAATTCCTCAATCTCGAGATTGAGGAATTTCAGCCGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073107    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031434.2-635s1c1
Sequence:CCGGGACACCATTGGCTCCTTGAAACTCGAGTTTCAAGGAGCCAATGGTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073106    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_031434.2-688s1c1
Sequence:CCGGGCGACTCATCTACCAAGGGCACTCGAGTGCCCTTGGTAGATGAGTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_031434
VALIDATED
TMUB1 MISSION shRNA shRNA Plasmid DNA
transmembrane and ubiquitin-like domain containing 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000428248    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031434.3-814s21c1
Sequence:CCGGTGAGACACAGAGGTCAAGCTGCTCGAGCAGCTTGACCTCTGTGTCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421048    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031434.3-1002s21c1
Sequence:CCGGGAACAGCAGGTGCGACTCATCCTCGAGGATGAGTCGCACCTGCTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422691    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031434.3-1305s21c1
Sequence:CCGGCTCCTGGCCTTTGCCATGTACCTCGAGGTACATGGCAAAGGCCAGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427486    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031434.3-917s21c1
Sequence:CCGGATTCCTCAATGATTCAGAGCACTCGAGTGCTCTGAATCATTGAGGAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073105    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_031434.2-573s1c1
Sequence:CCGGCCCTCGTGCTACGGCTGAAATCTCGAGATTTCAGCCGTAGCACGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073103    
Product Details
Validated
Region:UNK Mean KnockDown Level: 0.82 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_031434.2-1438s1c1
Sequence:CCGGGAACCCGTGCAGATTAAAGTACTCGAGTACTTTAATCTGCACGGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073104    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_031434.2-581s1c1
Sequence:CCGGCTACGGCTGAAATTCCTCAATCTCGAGATTGAGGAATTTCAGCCGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073107    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031434.2-635s1c1
Sequence:CCGGGACACCATTGGCTCCTTGAAACTCGAGTTTCAAGGAGCCAATGGTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073106    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_031434.2-688s1c1
Sequence:CCGGGCGACTCATCTACCAAGGGCACTCGAGTGCCCTTGGTAGATGAGTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_031434
VALIDATED
TMUB1 MISSION shRNA Lentiviral Transduction Particles
transmembrane and ubiquitin-like domain containing 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000428248    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031434.3-814s21c1
Sequence:CCGGTGAGACACAGAGGTCAAGCTGCTCGAGCAGCTTGACCTCTGTGTCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421048    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031434.3-1002s21c1
Sequence:CCGGGAACAGCAGGTGCGACTCATCCTCGAGGATGAGTCGCACCTGCTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422691    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031434.3-1305s21c1
Sequence:CCGGCTCCTGGCCTTTGCCATGTACCTCGAGGTACATGGCAAAGGCCAGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427486    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031434.3-917s21c1
Sequence:CCGGATTCCTCAATGATTCAGAGCACTCGAGTGCTCTGAATCATTGAGGAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073105    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_031434.2-573s1c1
Sequence:CCGGCCCTCGTGCTACGGCTGAAATCTCGAGATTTCAGCCGTAGCACGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073103    
Product Details
Validated
Region:UNK Mean KnockDown Level: 0.82 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_031434.2-1438s1c1
Sequence:CCGGGAACCCGTGCAGATTAAAGTACTCGAGTACTTTAATCTGCACGGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073104    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_031434.2-581s1c1
Sequence:CCGGCTACGGCTGAAATTCCTCAATCTCGAGATTGAGGAATTTCAGCCGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073107    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031434.2-635s1c1
Sequence:CCGGGACACCATTGGCTCCTTGAAACTCGAGTTTCAAGGAGCCAATGGTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073106    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_031434.2-688s1c1
Sequence:CCGGGCGACTCATCTACCAAGGGCACTCGAGTGCCCTTGGTAGATGAGTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022418
TMUB1 MISSION shRNA Bacterial Glycerol Stock
transmembrane and ubiquitin-like domain containing 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000175583    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022418.1-174s1c1
Sequence:CCGGCAACACATACCACTGAGAGTACTCGAGTACTCTCAGTGGTATGTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000174365    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022418.1-1138s1c1
Sequence:CCGGCAGAGGATCTAGATACTTCTACTCGAGTAGAAGTATCTAGATCCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173984    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022418.1-1131s1c1
Sequence:CCGGGTGCTGACAGAGGATCTAGATCTCGAGATCTAGATCCTCTGTCAGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000174690    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022418.1-403s1c1
Sequence:CCGGGAAATTTCTCAATGACTCTGACTCGAGTCAGAGTCATTGAGAAATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193826    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_022418.1-1156s1c1
Sequence:CCGGCTAGTTTCAAAGAGCTGCCTACTCGAGTAGGCAGCTCTTTGAAACTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022418
TMUB1 MISSION shRNA shRNA Plasmid DNA
transmembrane and ubiquitin-like domain containing 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000175583    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022418.1-174s1c1
Sequence:CCGGCAACACATACCACTGAGAGTACTCGAGTACTCTCAGTGGTATGTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000174365    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022418.1-1138s1c1
Sequence:CCGGCAGAGGATCTAGATACTTCTACTCGAGTAGAAGTATCTAGATCCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173984    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022418.1-1131s1c1
Sequence:CCGGGTGCTGACAGAGGATCTAGATCTCGAGATCTAGATCCTCTGTCAGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000174690    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022418.1-403s1c1
Sequence:CCGGGAAATTTCTCAATGACTCTGACTCGAGTCAGAGTCATTGAGAAATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193826    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_022418.1-1156s1c1
Sequence:CCGGCTAGTTTCAAAGAGCTGCCTACTCGAGTAGGCAGCTCTTTGAAACTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022418
TMUB1 MISSION shRNA Lentiviral Transduction Particles
transmembrane and ubiquitin-like domain containing 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000175583    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022418.1-174s1c1
Sequence:CCGGCAACACATACCACTGAGAGTACTCGAGTACTCTCAGTGGTATGTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000174365    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022418.1-1138s1c1
Sequence:CCGGCAGAGGATCTAGATACTTCTACTCGAGTAGAAGTATCTAGATCCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173984    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022418.1-1131s1c1
Sequence:CCGGGTGCTGACAGAGGATCTAGATCTCGAGATCTAGATCCTCTGTCAGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000174690    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022418.1-403s1c1
Sequence:CCGGGAAATTTCTCAATGACTCTGACTCGAGTCAGAGTCATTGAGAAATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193826    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_022418.1-1156s1c1
Sequence:CCGGCTAGTTTCAAAGAGCTGCCTACTCGAGTAGGCAGCTCTTTGAAACTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks