EMAIL THIS PAGE TO A FRIEND

TMUB2

transmembrane and ubiquitin-like domain containing 2

UniProtKB ID: Q71RG4, B3KU81, Q8NDI2, Q9BPZ5, Q9HAG3
Gene ID:
Mouse(72053) transmembrane and ubiquitin-like domain containing 2
Rat(303567) transmembrane and ubiquitin-like domain containing 2
Zebrafish(368511) transmembrane and ubiquitin-like domain containing 2
domestic cat(101098268) transmembrane and ubiquitin-like domain containing 2
dog(607070) transmembrane and ubiquitin-like domain containing 2
naked mole-rat(101720842) transmembrane and ubiquitin-like domain containing 2
domestic guinea pig(100729058) transmembrane and ubiquitin-like domain containing 2
cow(614388) transmembrane and ubiquitin-like domain containing 2
sheep(101115636) transmembrane and ubiquitin-like domain containing 2
232 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024107 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024107 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024107 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_028076 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028076 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028076 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001076674 Rosetta Predictions human pricing
NM_024107 Rosetta Predictions human pricing
NM_177441 Rosetta Predictions human pricing
NM_001031651 Rosetta Predictions rat pricing
NM_028076 Rosetta Predictions mouse pricing
XM_001003487 Rosetta Predictions mouse pricing
XM_126502 Rosetta Predictions mouse pricing
XM_895149 Rosetta Predictions mouse pricing
XM_903057 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001076674 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00311936 predicted 687
2 SASI_Hs02_00311937 predicted 980
3 SASI_Hs02_00311938 predicted 857
4 SASI_Hs02_00311939 predicted 833
5 SASI_Hs02_00311940 predicted 953
6 SASI_Hs02_00311941 predicted 751
7 SASI_Hs02_00311942 predicted 1212
8 SASI_Hs02_00311943 predicted 462
9 SASI_Hs02_00311944 predicted 1020
10 SASI_Hs02_00311945 predicted 1372
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024107 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00356594 predicted 614
2 SASI_Hs02_00356595 predicted 911
3 SASI_Hs01_00110740 predicted 793
4 SASI_Hs01_00110742 predicted 771
5 SASI_Hs01_00110743 predicted 886
6 SASI_Hs02_00356596 predicted 690
7 SASI_Hs01_00110745 predicted 1148
8 SASI_Hs02_00356597 predicted 392
9 SASI_Hs01_00110746 predicted 950
10 SASI_Hs02_00356598 predicted 1305
11 SASI_Hs01_00110739 predicted 711
12 SASI_Hs01_00110741 predicted 436
13 SASI_Hs01_00110744 predicted 514
14 SASI_Hs01_00110747 predicted 751
15 SASI_Hs01_00110748 predicted 666
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177441 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00089511 predicted 1120
2 SASI_Hs01_00089512 predicted 1414
3 SASI_Hs01_00089513 predicted 1295
4 SASI_Hs01_00089514 predicted 1273
5 SASI_Hs01_00089509 predicted 1383
6 SASI_Hs01_00089515 predicted 1183
7 SASI_Hs01_00089516 predicted 1644
8 SASI_Hs01_00089517 predicted 898
9 SASI_Hs02_00369340 predicted 1448
10 SASI_Hs02_00369341 predicted 1807
11 SASI_Hs01_00089510 predicted 1119
12 SASI_Hs01_00089518 predicted 1858
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001031651 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00111826 predicted 865
2 SASI_Rn02_00203594 predicted 861
3 SASI_Rn01_00111827 predicted 1173
4 SASI_Rn01_00111829 predicted 1161
5 SASI_Rn01_00111830 predicted 1404
6 SASI_Rn01_00111831 predicted 1260
7 SASI_Rn02_00203595 predicted 982
8 SASI_Rn01_00111833 predicted 1327
9 SASI_Rn01_00111834 predicted 1078
10 SASI_Rn02_00203596 predicted 1174
11 SASI_Rn01_00111828 predicted 1004
12 SASI_Rn01_00111832 predicted 986
13 SASI_Rn01_00111835 predicted 546
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028076 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00333294 predicted 761
2 SASI_Mm02_00333295 predicted 221
3 SASI_Mm02_00333296 predicted 669
4 SASI_Mm02_00333297 predicted 1043
5 SASI_Mm02_00333298 predicted 933
6 SASI_Mm02_00333299 predicted 1076
7 SASI_Mm02_00333300 predicted 837
8 SASI_Mm02_00333301 predicted 1080
9 SASI_Mm02_00333302 predicted 211
10 SASI_Mm02_00333303 predicted 309
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001003487 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00243817 predicted 822
2 SASI_Mm01_00243818 predicted 933
3 SASI_Mm01_00243819 predicted 1177
4 SASI_Mm01_00243820 predicted 1281
5 SASI_Mm01_00243821 predicted 1275
6 SASI_Mm01_00243822 predicted 640
7 SASI_Mm01_00243823 predicted 1015
8 SASI_Mm01_00243824 predicted 1044
9 SASI_Mm01_00243825 predicted 910
10 SASI_Mm01_00243826 predicted 796
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_126502 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00266654 predicted 1699
2 SASI_Mm01_00266655 predicted 1815
3 SASI_Mm01_00266656 predicted 2058
4 SASI_Mm01_00266657 predicted 2166
5 SASI_Mm01_00266658 predicted 2155
6 SASI_Mm01_00266659 predicted 2132
7 SASI_Mm01_00266660 predicted 1526
8 SASI_Mm01_00266661 predicted 1892
9 SASI_Mm01_00266662 predicted 1929
10 SASI_Mm01_00266663 predicted 1782
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_895149 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00236039 predicted 1002
2 SASI_Mm01_00236040 predicted 1535
3 SASI_Mm01_00236041 predicted 1350
4 SASI_Mm01_00236042 predicted 1333
5 SASI_Mm01_00236043 predicted 1315
6 SASI_Mm01_00236044 predicted 1529
7 SASI_Mm01_00236045 predicted 709
8 SASI_Mm01_00236046 predicted 1076
9 SASI_Mm01_00236047 predicted 970
10 SASI_Mm01_00236048 predicted 1333
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_903057 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00264753 predicted 552
2 SASI_Mm01_00264754 predicted 668
3 SASI_Mm01_00264755 predicted 901
4 SASI_Mm01_00264756 predicted 1018
5 SASI_Mm01_00264757 predicted 1004
6 SASI_Mm01_00264758 predicted 973
7 SASI_Mm01_00264759 predicted 373
8 SASI_Mm01_00264760 predicted 735
9 SASI_Mm01_00264761 predicted 781
10 SASI_Mm01_00264762 predicted 638
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024107
VALIDATED
TMUB2 MISSION shRNA Bacterial Glycerol Stock
transmembrane and ubiquitin-like domain containing 2
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000022419    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024107.1-775s1c1
Sequence:CCGGCGATAAGGACATAGGAAGAAACTCGAGTTTCTTCCTATGTCCTTATCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022420    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024107.1-402s1c1
Sequence:CCGGCCCATCCATCAGAGGCAAATACTCGAGTATTTGCCTCTGATGGATGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022422    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024107.1-196s1c1
Sequence:CCGGTGTGGGTAATGAGGTGATGGTCTCGAGACCATCACCTCATTACCCACATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022423    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_024107.1-257s1c1
Sequence:CCGGGCTTGGCTCTCTACCTACGTACTCGAGTACGTAGGTAGAGAGCCAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022421    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_024107.1-274s1c1
Sequence:CCGGCGTAGCAGACAGCGGTAGCAACTCGAGTTGCTACCGCTGTCTGCTACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433761    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024107.2-767s21c1
Sequence:CCGGACTGCGTTCTCTGAACATTACCTCGAGGTAATGTTCAGAGAACGCAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412279    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024107.2-931s21c1
Sequence:CCGGTGTTGGGTGTGGTCTGGTACTCTCGAGAGTACCAGACCACACCCAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412305    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024107.2-607s21c1
Sequence:CCGGTCATCACTGTGCGGCTCAAATCTCGAGATTTGAGCCGCACAGTGATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413927    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024107.2-1249s21c1
Sequence:CCGGGAGCACAACTCAGGTAGAAATCTCGAGATTTCTACCTGAGTTGTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423127    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024107.2-953s21c1
Sequence:CCGGCCGAATCAATTACCGCCAATTCTCGAGAATTGGCGGTAATTGATTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433174    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024107.2-695s21c1
Sequence:CCGGATACTTCCCTGGACAAGAAAGCTCGAGCTTTCTTGTCCAGGGAAGTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024107
VALIDATED
TMUB2 MISSION shRNA shRNA Plasmid DNA
transmembrane and ubiquitin-like domain containing 2
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000022419    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024107.1-775s1c1
Sequence:CCGGCGATAAGGACATAGGAAGAAACTCGAGTTTCTTCCTATGTCCTTATCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022420    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024107.1-402s1c1
Sequence:CCGGCCCATCCATCAGAGGCAAATACTCGAGTATTTGCCTCTGATGGATGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022422    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024107.1-196s1c1
Sequence:CCGGTGTGGGTAATGAGGTGATGGTCTCGAGACCATCACCTCATTACCCACATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022423    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_024107.1-257s1c1
Sequence:CCGGGCTTGGCTCTCTACCTACGTACTCGAGTACGTAGGTAGAGAGCCAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022421    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_024107.1-274s1c1
Sequence:CCGGCGTAGCAGACAGCGGTAGCAACTCGAGTTGCTACCGCTGTCTGCTACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433761    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024107.2-767s21c1
Sequence:CCGGACTGCGTTCTCTGAACATTACCTCGAGGTAATGTTCAGAGAACGCAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412279    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024107.2-931s21c1
Sequence:CCGGTGTTGGGTGTGGTCTGGTACTCTCGAGAGTACCAGACCACACCCAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412305    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024107.2-607s21c1
Sequence:CCGGTCATCACTGTGCGGCTCAAATCTCGAGATTTGAGCCGCACAGTGATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413927    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024107.2-1249s21c1
Sequence:CCGGGAGCACAACTCAGGTAGAAATCTCGAGATTTCTACCTGAGTTGTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423127    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024107.2-953s21c1
Sequence:CCGGCCGAATCAATTACCGCCAATTCTCGAGAATTGGCGGTAATTGATTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433174    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024107.2-695s21c1
Sequence:CCGGATACTTCCCTGGACAAGAAAGCTCGAGCTTTCTTGTCCAGGGAAGTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024107
VALIDATED
TMUB2 MISSION shRNA Lentiviral Transduction Particles
transmembrane and ubiquitin-like domain containing 2
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000022419    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024107.1-775s1c1
Sequence:CCGGCGATAAGGACATAGGAAGAAACTCGAGTTTCTTCCTATGTCCTTATCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022420    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024107.1-402s1c1
Sequence:CCGGCCCATCCATCAGAGGCAAATACTCGAGTATTTGCCTCTGATGGATGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022422    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024107.1-196s1c1
Sequence:CCGGTGTGGGTAATGAGGTGATGGTCTCGAGACCATCACCTCATTACCCACATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022423    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_024107.1-257s1c1
Sequence:CCGGGCTTGGCTCTCTACCTACGTACTCGAGTACGTAGGTAGAGAGCCAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022421    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_024107.1-274s1c1
Sequence:CCGGCGTAGCAGACAGCGGTAGCAACTCGAGTTGCTACCGCTGTCTGCTACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433761    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024107.2-767s21c1
Sequence:CCGGACTGCGTTCTCTGAACATTACCTCGAGGTAATGTTCAGAGAACGCAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412279    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024107.2-931s21c1
Sequence:CCGGTGTTGGGTGTGGTCTGGTACTCTCGAGAGTACCAGACCACACCCAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412305    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024107.2-607s21c1
Sequence:CCGGTCATCACTGTGCGGCTCAAATCTCGAGATTTGAGCCGCACAGTGATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413927    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024107.2-1249s21c1
Sequence:CCGGGAGCACAACTCAGGTAGAAATCTCGAGATTTCTACCTGAGTTGTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423127    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024107.2-953s21c1
Sequence:CCGGCCGAATCAATTACCGCCAATTCTCGAGAATTGGCGGTAATTGATTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433174    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024107.2-695s21c1
Sequence:CCGGATACTTCCCTGGACAAGAAAGCTCGAGCTTTCTTGTCCAGGGAAGTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028076
VALIDATED
TMUB2 MISSION shRNA Bacterial Glycerol Stock
transmembrane and ubiquitin-like domain containing 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000252999    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_028076.2-1070s21c1
Sequence:CCGGTTCTTCAGCATCCTGGTATTTCTCGAGAAATACCAGGATGCTGAAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252998    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028076.2-672s21c1
Sequence:CCGGTTCGCCTCAAGTTCCTCAATGCTCGAGCATTGAGGAACTTGAGGCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252997    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_028076.2-395s21c1
Sequence:CCGGCATGTGGACCAGCTGGTAAACCTCGAGGTTTACCAGCTGGTCCACATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252996    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_028076.2-1615s21c1
Sequence:CCGGTGTAGCAGGAATAGGATATTTCTCGAGAAATATCCTATTCCTGCTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000267464    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_028076.2-996s21c1
Sequence:CCGGTCTGGTACTTCCGTATCAATTCTCGAGAATTGATACGGAAGTACCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028076
VALIDATED
TMUB2 MISSION shRNA shRNA Plasmid DNA
transmembrane and ubiquitin-like domain containing 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000252999    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_028076.2-1070s21c1
Sequence:CCGGTTCTTCAGCATCCTGGTATTTCTCGAGAAATACCAGGATGCTGAAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252998    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028076.2-672s21c1
Sequence:CCGGTTCGCCTCAAGTTCCTCAATGCTCGAGCATTGAGGAACTTGAGGCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252997    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_028076.2-395s21c1
Sequence:CCGGCATGTGGACCAGCTGGTAAACCTCGAGGTTTACCAGCTGGTCCACATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252996    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_028076.2-1615s21c1
Sequence:CCGGTGTAGCAGGAATAGGATATTTCTCGAGAAATATCCTATTCCTGCTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000267464    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_028076.2-996s21c1
Sequence:CCGGTCTGGTACTTCCGTATCAATTCTCGAGAATTGATACGGAAGTACCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028076
VALIDATED
TMUB2 MISSION shRNA Lentiviral Transduction Particles
transmembrane and ubiquitin-like domain containing 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000252999    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_028076.2-1070s21c1
Sequence:CCGGTTCTTCAGCATCCTGGTATTTCTCGAGAAATACCAGGATGCTGAAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252998    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028076.2-672s21c1
Sequence:CCGGTTCGCCTCAAGTTCCTCAATGCTCGAGCATTGAGGAACTTGAGGCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252997    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_028076.2-395s21c1
Sequence:CCGGCATGTGGACCAGCTGGTAAACCTCGAGGTTTACCAGCTGGTCCACATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252996    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_028076.2-1615s21c1
Sequence:CCGGTGTAGCAGGAATAGGATATTTCTCGAGAAATATCCTATTCCTGCTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000267464    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_028076.2-996s21c1
Sequence:CCGGTCTGGTACTTCCGTATCAATTCTCGAGAATTGATACGGAAGTACCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks