EMAIL THIS PAGE TO A FRIEND

TMX1

thioredoxin-related transmembrane protein 1

Synonyms: PDIA11 TMX TXNDC TXNDC1
UniProtKB ID: Q9H3N1, B2R7A4, Q8N487, Q8NBN5, Q9Y4T6
Gene ID:
Human(81542) Summary: TXNDC1 is a thioredoxin (TXN; see MIM 187700)-related protein with disulfide reductase activity (Matsuo et al., 2001 [PubMed 11152479]
Mouse(72736) thioredoxin-related transmembrane protein 1
Rat(362751) thioredoxin-related transmembrane protein 1
Zebrafish(323607) thioredoxin-related transmembrane protein 1
domestic cat(101096815) thioredoxin-related transmembrane protein 1
dog(610791) thioredoxin-related transmembrane protein 1
chicken(423580) thioredoxin-related transmembrane protein 1
cow(509037) thioredoxin-related transmembrane protein 1
sheep(101106015) thioredoxin-related transmembrane protein 1
domestic guinea pig(100730367) thioredoxin-related transmembrane protein 1
naked mole-rat(101720919) thioredoxin-related transmembrane protein 1
143 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_030755 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_030755 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_030755 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_028339 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028339 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028339 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_030755 Rosetta Predictions human pricing
NM_001024800 Rosetta Predictions rat pricing
NM_028339 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030755 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00063516 predicted 341
2 SASI_Hs01_00063518 predicted 501
3 SASI_Hs01_00063521 predicted 890
4 SASI_Hs01_00063523 predicted 474
5 SASI_Hs01_00063519 predicted 416
6 SASI_Hs01_00063524 predicted 801
7 SASI_Hs01_00063525 predicted 973
8 SASI_Hs02_00358273 predicted 215
9 SASI_Hs01_00063517 predicted 609
10 SASI_Hs02_00358274 predicted 552
11 SASI_Hs01_00063520 predicted 373
12 SASI_Hs01_00063522 predicted 366
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024800 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00202724 predicted 392
2 SASI_Rn01_00045271 predicted 419
3 SASI_Rn01_00045272 predicted 424
4 SASI_Rn01_00045273 predicted 625
5 SASI_Rn01_00045274 predicted 435
6 SASI_Rn01_00045275 predicted 463
7 SASI_Rn01_00045276 predicted 373
8 SASI_Rn01_00045277 predicted 937
9 SASI_Rn01_00045279 predicted 329
10 SASI_Rn02_00202725 predicted 326
11 SASI_Rn01_00045270 predicted 411
12 SASI_Rn01_00045278 predicted 324
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028339 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00029400 predicted 963
2 SASI_Mm01_00029401 predicted 1010
3 SASI_Mm01_00029402 predicted 231
4 SASI_Mm02_00333711 predicted 393
5 SASI_Mm01_00029404 predicted 350
6 SASI_Mm01_00029405 predicted 949
7 SASI_Mm01_00029406 predicted 302
8 SASI_Mm01_00029407 predicted 310
9 SASI_Mm01_00029408 predicted 310
10 SASI_Mm01_00029409 predicted 295
11 SASI_Mm01_00029403 predicted 896
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030755
VALIDATED
TMX1 MISSION shRNA Bacterial Glycerol Stock
thioredoxin-related transmembrane protein 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000338791    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_030755.4-2325s21c1
Sequence:CCGGGCTGTGTGAATCCATTAGATTCTCGAGAATCTAATGGATTCACACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000338583    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_030755.4-876s21c1
Sequence:CCGGGCTGAAAGTAAAGAAGGAACACTCGAGTGTTCCTTCTTTACTTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000338656    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_030755.4-392s21c1
Sequence:CCGGAGGACTGAGTGGACGGTTTATCTCGAGATAAACCGTCCACTCAGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000338653    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_030755.4-1198s21c1
Sequence:CCGGCGTGCCAAGCAATAAGATTTACTCGAGTAAATCTTATTGCTTGGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150291    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_030755.3-1148s1c1
Sequence:CCGGCGTGCCAAGCAATAAGATTTACTCGAGTAAATCTTATTGCTTGGCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147353    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_030755.3-826s1c1
Sequence:CCGGGCTGAAAGTAAAGAAGGAACACTCGAGTGTTCCTTCTTTACTTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148223    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_030755.3-2274s1c1
Sequence:CCGGGCTGTGTGAATCCATTAGATTCTCGAGAATCTAATGGATTCACACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000183053    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030755.3-355s1c1
Sequence:CCGGCGGTTTATCATAAATGCTCTTCTCGAGAAGAGCATTTATGATAAACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030755
VALIDATED
TMX1 MISSION shRNA shRNA Plasmid DNA
thioredoxin-related transmembrane protein 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000338791    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_030755.4-2325s21c1
Sequence:CCGGGCTGTGTGAATCCATTAGATTCTCGAGAATCTAATGGATTCACACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000338583    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_030755.4-876s21c1
Sequence:CCGGGCTGAAAGTAAAGAAGGAACACTCGAGTGTTCCTTCTTTACTTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000338656    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_030755.4-392s21c1
Sequence:CCGGAGGACTGAGTGGACGGTTTATCTCGAGATAAACCGTCCACTCAGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000338653    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_030755.4-1198s21c1
Sequence:CCGGCGTGCCAAGCAATAAGATTTACTCGAGTAAATCTTATTGCTTGGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150291    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_030755.3-1148s1c1
Sequence:CCGGCGTGCCAAGCAATAAGATTTACTCGAGTAAATCTTATTGCTTGGCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147353    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_030755.3-826s1c1
Sequence:CCGGGCTGAAAGTAAAGAAGGAACACTCGAGTGTTCCTTCTTTACTTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148223    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_030755.3-2274s1c1
Sequence:CCGGGCTGTGTGAATCCATTAGATTCTCGAGAATCTAATGGATTCACACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000183053    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030755.3-355s1c1
Sequence:CCGGCGGTTTATCATAAATGCTCTTCTCGAGAAGAGCATTTATGATAAACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030755
VALIDATED
TMX1 MISSION shRNA Lentiviral Transduction Particles
thioredoxin-related transmembrane protein 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000338791    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_030755.4-2325s21c1
Sequence:CCGGGCTGTGTGAATCCATTAGATTCTCGAGAATCTAATGGATTCACACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000338583    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_030755.4-876s21c1
Sequence:CCGGGCTGAAAGTAAAGAAGGAACACTCGAGTGTTCCTTCTTTACTTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000338656    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_030755.4-392s21c1
Sequence:CCGGAGGACTGAGTGGACGGTTTATCTCGAGATAAACCGTCCACTCAGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000338653    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_030755.4-1198s21c1
Sequence:CCGGCGTGCCAAGCAATAAGATTTACTCGAGTAAATCTTATTGCTTGGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150291    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_030755.3-1148s1c1
Sequence:CCGGCGTGCCAAGCAATAAGATTTACTCGAGTAAATCTTATTGCTTGGCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147353    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_030755.3-826s1c1
Sequence:CCGGGCTGAAAGTAAAGAAGGAACACTCGAGTGTTCCTTCTTTACTTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148223    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_030755.3-2274s1c1
Sequence:CCGGGCTGTGTGAATCCATTAGATTCTCGAGAATCTAATGGATTCACACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000183053    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030755.3-355s1c1
Sequence:CCGGCGGTTTATCATAAATGCTCTTCTCGAGAAGAGCATTTATGATAAACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028339
VALIDATED
TMX1 MISSION shRNA Bacterial Glycerol Stock
thioredoxin-related transmembrane protein 1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000329428    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028339.1-363s21c1
Sequence:CCGGCCCAAGGACTAAGAAGGACTTCTCGAGAAGTCCTTCTTAGTCCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000329431    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_028339.1-283s21c1
Sequence:CCGGGGACTAAGTGGACGGTTTATCCTCGAGGATAAACCGTCCACTTAGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000329429    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_028339.1-597s21c1
Sequence:CCGGGCTGGGACTTTGTATGATATTCTCGAGAATATCATACAAAGTCCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000329497    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028339.1-1257s21c1
Sequence:CCGGGCCCATTATTTCAAGACATATCTCGAGATATGTCTTGAAATAATGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000114326    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_028339.1-1257s1c1
Sequence:CCGGGCCCATTATTTCAAGACATATCTCGAGATATGTCTTGAAATAATGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000114328    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_028339.1-363s1c1
Sequence:CCGGCCCAAGGACTAAGAAGGACTTCTCGAGAAGTCCTTCTTAGTCCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000114327    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_028339.1-295s1c1
Sequence:CCGGCGGTTTATCATAACTGCTCTTCTCGAGAAGAGCAGTTATGATAAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000114329    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_028339.1-597s1c1
Sequence:CCGGGCTGGGACTTTGTATGATATTCTCGAGAATATCATACAAAGTCCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000114330    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028339.1-421s1c1
Sequence:CCGGGAACCTATATCATCATGGTTTCTCGAGAAACCATGATGATATAGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028339
VALIDATED
TMX1 MISSION shRNA shRNA Plasmid DNA
thioredoxin-related transmembrane protein 1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000329428    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028339.1-363s21c1
Sequence:CCGGCCCAAGGACTAAGAAGGACTTCTCGAGAAGTCCTTCTTAGTCCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000329431    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_028339.1-283s21c1
Sequence:CCGGGGACTAAGTGGACGGTTTATCCTCGAGGATAAACCGTCCACTTAGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000329429    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_028339.1-597s21c1
Sequence:CCGGGCTGGGACTTTGTATGATATTCTCGAGAATATCATACAAAGTCCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000329497    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028339.1-1257s21c1
Sequence:CCGGGCCCATTATTTCAAGACATATCTCGAGATATGTCTTGAAATAATGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000114326    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_028339.1-1257s1c1
Sequence:CCGGGCCCATTATTTCAAGACATATCTCGAGATATGTCTTGAAATAATGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000114328    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_028339.1-363s1c1
Sequence:CCGGCCCAAGGACTAAGAAGGACTTCTCGAGAAGTCCTTCTTAGTCCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000114327    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_028339.1-295s1c1
Sequence:CCGGCGGTTTATCATAACTGCTCTTCTCGAGAAGAGCAGTTATGATAAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000114329    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_028339.1-597s1c1
Sequence:CCGGGCTGGGACTTTGTATGATATTCTCGAGAATATCATACAAAGTCCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000114330    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028339.1-421s1c1
Sequence:CCGGGAACCTATATCATCATGGTTTCTCGAGAAACCATGATGATATAGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028339
VALIDATED
TMX1 MISSION shRNA Lentiviral Transduction Particles
thioredoxin-related transmembrane protein 1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000329428    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028339.1-363s21c1
Sequence:CCGGCCCAAGGACTAAGAAGGACTTCTCGAGAAGTCCTTCTTAGTCCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000329431    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_028339.1-283s21c1
Sequence:CCGGGGACTAAGTGGACGGTTTATCCTCGAGGATAAACCGTCCACTTAGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000329429    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_028339.1-597s21c1
Sequence:CCGGGCTGGGACTTTGTATGATATTCTCGAGAATATCATACAAAGTCCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000329497    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028339.1-1257s21c1
Sequence:CCGGGCCCATTATTTCAAGACATATCTCGAGATATGTCTTGAAATAATGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000114326    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_028339.1-1257s1c1
Sequence:CCGGGCCCATTATTTCAAGACATATCTCGAGATATGTCTTGAAATAATGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000114328    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_028339.1-363s1c1
Sequence:CCGGCCCAAGGACTAAGAAGGACTTCTCGAGAAGTCCTTCTTAGTCCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000114327    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_028339.1-295s1c1
Sequence:CCGGCGGTTTATCATAACTGCTCTTCTCGAGAAGAGCAGTTATGATAAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000114329    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_028339.1-597s1c1
Sequence:CCGGGCTGGGACTTTGTATGATATTCTCGAGAATATCATACAAAGTCCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000114330    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028339.1-421s1c1
Sequence:CCGGGAACCTATATCATCATGGTTTCTCGAGAAACCATGATGATATAGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks