EMAIL THIS PAGE TO A FRIEND

TMX2

thioredoxin-related transmembrane protein 2

Synonyms: PDIA12 PIG26 TXNDC14
Gene ID:
Mouse(66958) thioredoxin-related transmembrane protein 2
Rat(295701) thioredoxin-related transmembrane protein 2
naked mole-rat(101720299) thioredoxin-related transmembrane protein 2
domestic guinea pig(100735434) thioredoxin-related transmembrane protein 2
cow(509244) thioredoxin-related transmembrane protein 2
sheep(101106281) thioredoxin-related transmembrane protein 2
chicken(428853) thioredoxin-related transmembrane protein 2
dog(475964) thioredoxin-related transmembrane protein 2
domestic cat(101095680) thioredoxin-related transmembrane protein 2
58 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015959 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015959 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015959 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_025868 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025868 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025868 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015959 Rosetta Predictions human pricing
NM_001007643 Rosetta Predictions rat pricing
NM_025868 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015959 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00075522 predicted 645
2 SASI_Hs01_00075523 predicted 531
3 SASI_Hs01_00075524 predicted 841
4 SASI_Hs01_00075525 predicted 791
5 SASI_Hs01_00075526 predicted 447
6 SASI_Hs02_00348615 predicted 302
7 SASI_Hs02_00348616 predicted 517
8 SASI_Hs01_00075528 predicted 544
9 SASI_Hs01_00075529 predicted 758
10 SASI_Hs01_00075530 predicted 967
11 SASI_Hs01_00075527 predicted 458
12 SASI_Hs01_00075531 predicted 504
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001007643 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00100846 predicted 1171
2 SASI_Rn01_00100847 predicted 987
3 SASI_Rn02_00198758 predicted 808
4 SASI_Rn01_00100848 predicted 965
5 SASI_Rn01_00100849 predicted 948
6 SASI_Rn01_00100850 predicted 710
7 SASI_Rn01_00100851 predicted 1017
8 SASI_Rn01_00100852 predicted 903
9 SASI_Rn01_00100853 predicted 889
10 SASI_Rn01_00100854 predicted 435
11 SASI_Rn01_00100855 predicted 916
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025868 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00022110 predicted 754
2 SASI_Mm01_00022111 predicted 410
3 SASI_Mm01_00022112 predicted 555
4 SASI_Mm01_00022113 predicted 282
5 SASI_Mm01_00022114 predicted 514
6 SASI_Mm01_00022115 predicted 608
7 SASI_Mm01_00022116 predicted 689
8 SASI_Mm02_00329185 predicted 489
9 SASI_Mm01_00022117 predicted 477
10 SASI_Mm01_00022119 predicted 418
11 SASI_Mm01_00022118 predicted 489
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015959
VALIDATED
TMX2 MISSION shRNA Bacterial Glycerol Stock
thioredoxin-related transmembrane protein 2
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000064408    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015959.1-743s1c1
Sequence:CCGGCGGCCACAGATTGACAAGAAACTCGAGTTTCTTGTCAATCTGTGGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064411    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_015959.1-152s1c1
Sequence:CCGGGCCTTCCTACTCGTGAGGAAACTCGAGTTTCCTCACGAGTAGGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064412    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_015959.1-794s1c1
Sequence:CCGGGAGAATGTGATCCGAGAATTTCTCGAGAAATTCTCGGATCACATTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064410    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_015959.1-639s1c1
Sequence:CCGGGACGCTATACTGATGTTAGTACTCGAGTACTAACATCAGTATAGCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064409    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_015959.1-253s1c1
Sequence:CCGGCCTGATGTTTCTCAGTGCCATCTCGAGATGGCACTGAGAAACATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000298613    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_015959.2-1299s21c1
Sequence:CCGGAGCTTGGTTAGACCTAGATTTCTCGAGAAATCTAGGTCTAACCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000286452    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 2 Clone ID:NM_015959.2-639s21c1
Sequence:CCGGGACGCTATACTGATGTTAGTACTCGAGTACTAACATCAGTATAGCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000286450    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_015959.2-152s21c1
Sequence:CCGGGCCTTCCTACTCGTGAGGAAACTCGAGTTTCCTCACGAGTAGGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000286518    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_015959.2-794s21c1
Sequence:CCGGGAGAATGTGATCCGAGAATTTCTCGAGAAATTCTCGGATCACATTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000298615    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_015959.2-376s21c1
Sequence:CCGGTATTCGCATGGGCCTACTTTACTCGAGTAAAGTAGGCCCATGCGAATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015959
VALIDATED
TMX2 MISSION shRNA shRNA Plasmid DNA
thioredoxin-related transmembrane protein 2
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000064408    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015959.1-743s1c1
Sequence:CCGGCGGCCACAGATTGACAAGAAACTCGAGTTTCTTGTCAATCTGTGGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064411    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_015959.1-152s1c1
Sequence:CCGGGCCTTCCTACTCGTGAGGAAACTCGAGTTTCCTCACGAGTAGGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064412    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_015959.1-794s1c1
Sequence:CCGGGAGAATGTGATCCGAGAATTTCTCGAGAAATTCTCGGATCACATTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064410    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_015959.1-639s1c1
Sequence:CCGGGACGCTATACTGATGTTAGTACTCGAGTACTAACATCAGTATAGCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064409    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_015959.1-253s1c1
Sequence:CCGGCCTGATGTTTCTCAGTGCCATCTCGAGATGGCACTGAGAAACATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000298613    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_015959.2-1299s21c1
Sequence:CCGGAGCTTGGTTAGACCTAGATTTCTCGAGAAATCTAGGTCTAACCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000286452    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 2 Clone ID:NM_015959.2-639s21c1
Sequence:CCGGGACGCTATACTGATGTTAGTACTCGAGTACTAACATCAGTATAGCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000286450    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_015959.2-152s21c1
Sequence:CCGGGCCTTCCTACTCGTGAGGAAACTCGAGTTTCCTCACGAGTAGGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000286518    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_015959.2-794s21c1
Sequence:CCGGGAGAATGTGATCCGAGAATTTCTCGAGAAATTCTCGGATCACATTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000298615    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_015959.2-376s21c1
Sequence:CCGGTATTCGCATGGGCCTACTTTACTCGAGTAAAGTAGGCCCATGCGAATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015959
VALIDATED
TMX2 MISSION shRNA Lentiviral Transduction Particles
thioredoxin-related transmembrane protein 2
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000064408    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015959.1-743s1c1
Sequence:CCGGCGGCCACAGATTGACAAGAAACTCGAGTTTCTTGTCAATCTGTGGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064411    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_015959.1-152s1c1
Sequence:CCGGGCCTTCCTACTCGTGAGGAAACTCGAGTTTCCTCACGAGTAGGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064412    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_015959.1-794s1c1
Sequence:CCGGGAGAATGTGATCCGAGAATTTCTCGAGAAATTCTCGGATCACATTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064410    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_015959.1-639s1c1
Sequence:CCGGGACGCTATACTGATGTTAGTACTCGAGTACTAACATCAGTATAGCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064409    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_015959.1-253s1c1
Sequence:CCGGCCTGATGTTTCTCAGTGCCATCTCGAGATGGCACTGAGAAACATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000298613    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_015959.2-1299s21c1
Sequence:CCGGAGCTTGGTTAGACCTAGATTTCTCGAGAAATCTAGGTCTAACCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000286452    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 2 Clone ID:NM_015959.2-639s21c1
Sequence:CCGGGACGCTATACTGATGTTAGTACTCGAGTACTAACATCAGTATAGCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000286450    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_015959.2-152s21c1
Sequence:CCGGGCCTTCCTACTCGTGAGGAAACTCGAGTTTCCTCACGAGTAGGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000286518    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_015959.2-794s21c1
Sequence:CCGGGAGAATGTGATCCGAGAATTTCTCGAGAAATTCTCGGATCACATTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000298615    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_015959.2-376s21c1
Sequence:CCGGTATTCGCATGGGCCTACTTTACTCGAGTAAAGTAGGCCCATGCGAATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025868
VALIDATED
TMX2 MISSION shRNA Bacterial Glycerol Stock
thioredoxin-related transmembrane protein 2
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000125914    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025868.1-1262s1c1
Sequence:CCGGCCCTAATGTTAGATGTCAGTACTCGAGTACTGACATCTAACATTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125918    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025868.1-277s1c1
Sequence:CCGGGTAGGCAACATCTTTATGTTTCTCGAGAAACATAAAGATGTTGCCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125915    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025868.1-357s1c1
Sequence:CCGGCCTCACACTCTGCATAGTGTTCTCGAGAACACTATGCAGAGTGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125917    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025868.1-519s1c1
Sequence:CCGGCCAATCCTTTGCTCCCATCTACTCGAGTAGATGGGAGCAAAGGATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125916    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025868.1-661s1c1
Sequence:CCGGCCTACCCTGATTCTGTTCCAACTCGAGTTGGAACAGAATCAGGGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000328596    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025868.3-559s21c1
Sequence:CCGGACAACTGTTCAGGGCTAAATTCTCGAGAATTTAGCCCTGAACAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000328535    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025868.3-402s21c1
Sequence:CCGGTACATGGGTCCTGAGTATATCCTCGAGGATATACTCAGGACCCATGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000328537    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025868.3-771s21c1
Sequence:CCGGTTCAACTTGAATGAGCTATACCTCGAGGTATAGCTCATTCAAGTTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000328534    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025868.3-610s21c1
Sequence:CCGGACGTTAGCACACGGTACAAAGCTCGAGCTTTGTACCGTGTGCTAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000328597    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025868.3-1182s21c1
Sequence:CCGGCTATTCAACACTTGGATATTACTCGAGTAATATCCAAGTGTTGAATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025868
VALIDATED
TMX2 MISSION shRNA shRNA Plasmid DNA
thioredoxin-related transmembrane protein 2
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000125914    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025868.1-1262s1c1
Sequence:CCGGCCCTAATGTTAGATGTCAGTACTCGAGTACTGACATCTAACATTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125918    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025868.1-277s1c1
Sequence:CCGGGTAGGCAACATCTTTATGTTTCTCGAGAAACATAAAGATGTTGCCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125915    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025868.1-357s1c1
Sequence:CCGGCCTCACACTCTGCATAGTGTTCTCGAGAACACTATGCAGAGTGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125917    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025868.1-519s1c1
Sequence:CCGGCCAATCCTTTGCTCCCATCTACTCGAGTAGATGGGAGCAAAGGATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125916    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025868.1-661s1c1
Sequence:CCGGCCTACCCTGATTCTGTTCCAACTCGAGTTGGAACAGAATCAGGGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000328596    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025868.3-559s21c1
Sequence:CCGGACAACTGTTCAGGGCTAAATTCTCGAGAATTTAGCCCTGAACAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000328535    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025868.3-402s21c1
Sequence:CCGGTACATGGGTCCTGAGTATATCCTCGAGGATATACTCAGGACCCATGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000328537    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025868.3-771s21c1
Sequence:CCGGTTCAACTTGAATGAGCTATACCTCGAGGTATAGCTCATTCAAGTTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000328534    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025868.3-610s21c1
Sequence:CCGGACGTTAGCACACGGTACAAAGCTCGAGCTTTGTACCGTGTGCTAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000328597    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025868.3-1182s21c1
Sequence:CCGGCTATTCAACACTTGGATATTACTCGAGTAATATCCAAGTGTTGAATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025868
VALIDATED
TMX2 MISSION shRNA Lentiviral Transduction Particles
thioredoxin-related transmembrane protein 2
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000125914    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025868.1-1262s1c1
Sequence:CCGGCCCTAATGTTAGATGTCAGTACTCGAGTACTGACATCTAACATTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125918    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025868.1-277s1c1
Sequence:CCGGGTAGGCAACATCTTTATGTTTCTCGAGAAACATAAAGATGTTGCCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125915    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025868.1-357s1c1
Sequence:CCGGCCTCACACTCTGCATAGTGTTCTCGAGAACACTATGCAGAGTGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125917    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025868.1-519s1c1
Sequence:CCGGCCAATCCTTTGCTCCCATCTACTCGAGTAGATGGGAGCAAAGGATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125916    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025868.1-661s1c1
Sequence:CCGGCCTACCCTGATTCTGTTCCAACTCGAGTTGGAACAGAATCAGGGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000328596    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025868.3-559s21c1
Sequence:CCGGACAACTGTTCAGGGCTAAATTCTCGAGAATTTAGCCCTGAACAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000328535    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025868.3-402s21c1
Sequence:CCGGTACATGGGTCCTGAGTATATCCTCGAGGATATACTCAGGACCCATGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000328537    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025868.3-771s21c1
Sequence:CCGGTTCAACTTGAATGAGCTATACCTCGAGGTATAGCTCATTCAAGTTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000328534    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025868.3-610s21c1
Sequence:CCGGACGTTAGCACACGGTACAAAGCTCGAGCTTTGTACCGTGTGCTAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000328597    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025868.3-1182s21c1
Sequence:CCGGCTATTCAACACTTGGATATTACTCGAGTAATATCCAAGTGTTGAATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks