EMAIL THIS PAGE TO A FRIEND

TMX3

thioredoxin-related transmembrane protein 3

Synonyms: PDIA13 TXNDC10
UniProtKB ID: Q96JJ7, B3KV75, Q52LT7, Q8N5J0, Q9NWJ9
Gene ID:
Mouse(67988) thioredoxin-related transmembrane protein 3
Rat(682967) thioredoxin-related transmembrane protein 3
Zebrafish(553578) thioredoxin-related transmembrane protein 3
domestic cat(101087107) thioredoxin-related transmembrane protein 3
Horse(100051906) thioredoxin-related transmembrane protein 3
dog(476176) thioredoxin-related transmembrane protein 3
chicken(421027) thioredoxin-related transmembrane protein 3
cow(615687) thioredoxin-related transmembrane protein 3
sheep(101113033) thioredoxin-related transmembrane protein 3
domestic guinea pig(100733489) thioredoxin-related transmembrane protein 3
naked mole-rat(101708762) thioredoxin-related transmembrane protein 3
116 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_198295 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_198295 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_198295 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_019022 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_019022 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_019022 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_019022 Rosetta Predictions human pricing
XM_001063895 Rosetta Predictions rat pricing
NM_198295 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019022 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00103576 predicted 375
2 SASI_Hs01_00103577 predicted 824
3 SASI_Hs01_00103578 predicted 195
4 SASI_Hs01_00103579 predicted 214
5 SASI_Hs01_00103580 predicted 1342
6 SASI_Hs01_00103581 predicted 1225
7 SASI_Hs02_00352561 predicted 681
8 SASI_Hs01_00103582 predicted 523
9 SASI_Hs01_00103583 predicted 419
10 SASI_Hs02_00352562 predicted 361
11 SASI_Hs01_00103584 predicted 1085
12 SASI_Hs01_00103585 predicted 1103
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001063895 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00308652 predicted 634
2 SASI_Rn02_00308653 predicted 681
3 SASI_Rn02_00308654 predicted 1840
4 SASI_Rn02_00308655 predicted 1252
5 SASI_Rn02_00308656 predicted 1605
6 SASI_Rn02_00308657 predicted 1179
7 SASI_Rn02_00308658 predicted 1745
8 SASI_Rn02_00308659 predicted 583
9 SASI_Rn02_00308660 predicted 1489
10 SASI_Rn02_00308661 predicted 1189
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198295 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00125479 predicted 1395
2 SASI_Mm02_00350907 predicted 466
3 SASI_Mm01_00125480 predicted 1084
4 SASI_Mm01_00125484 predicted 968
5 SASI_Mm01_00125485 predicted 1526
6 SASI_Mm02_00350908 predicted 362
7 SASI_Mm01_00125487 predicted 1263
8 SASI_Mm01_00125488 predicted 1059
9 SASI_Mm02_00350909 predicted 496
10 SASI_Mm02_00350910 predicted 574
11 SASI_Mm01_00125481 predicted 1099
12 SASI_Mm01_00125482 predicted 520
13 SASI_Mm01_00125483 predicted 514
14 SASI_Mm01_00125486 predicted 718
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198295
VALIDATED
TMX3 MISSION shRNA Bacterial Glycerol Stock
thioredoxin-related transmembrane protein 3
Mouse
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000436730    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198295.2-744s21c1
Sequence:CCGGCTGAGTACGTGACGCTGAAAGCTCGAGCTTTCAGCGTCACGTACTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430672    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198295.2-616s21c1
Sequence:CCGGACGGAAGAGGCACCGTGTATTCTCGAGAATACACGGTGCCTCTTCCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418806    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198295.2-1400s21c1
Sequence:CCGGGAACGATATGAAGTATCTAAACTCGAGTTTAGATACTTCATATCGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414545    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198295.2-526s21c1
Sequence:CCGGACGGACTAAAGATGATATAATCTCGAGATTATATCATCTTTAGTCCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413236    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198295.2-393s21c1
Sequence:CCGGGTATTGGTTCTCCAGTTAAAGCTCGAGCTTTAACTGGAGAACCAATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413952    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198295.2-1376s21c1
Sequence:CCGGGACACAGATGGAGGCTATATACTCGAGTATATAGCCTCCATCTGTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414247    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198295.2-1886s21c1
Sequence:CCGGAGTACTTTCACCTACTATATCCTCGAGGATATAGTAGGTGAAAGTACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124249    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198295.1-1210s1c1
Sequence:CCGGGCCAGATCATTGTATCAATTACTCGAGTAATTGATACAATGATCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124250    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_198295.1-565s1c1
Sequence:CCGGCCAACAATAGTTGTACTGAATCTCGAGATTCAGTACAACTATTGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124253    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198295.1-766s1c1
Sequence:CCGGTCTCCACTTATGGGCTGCTTTCTCGAGAAAGCAGCCCATAAGTGGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124252    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_198295.1-432s1c1
Sequence:CCGGGCATACCAGATTAAAGTCAATCTCGAGATTGACTTTAATCTGGTATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124251    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198295.1-336s1c1
Sequence:CCGGCTACCTTACTATGGATGGTTTCTCGAGAAACCATCCATAGTAAGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198295
VALIDATED
TMX3 MISSION shRNA shRNA Plasmid DNA
thioredoxin-related transmembrane protein 3
Mouse
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000436730    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198295.2-744s21c1
Sequence:CCGGCTGAGTACGTGACGCTGAAAGCTCGAGCTTTCAGCGTCACGTACTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430672    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198295.2-616s21c1
Sequence:CCGGACGGAAGAGGCACCGTGTATTCTCGAGAATACACGGTGCCTCTTCCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418806    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198295.2-1400s21c1
Sequence:CCGGGAACGATATGAAGTATCTAAACTCGAGTTTAGATACTTCATATCGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414545    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198295.2-526s21c1
Sequence:CCGGACGGACTAAAGATGATATAATCTCGAGATTATATCATCTTTAGTCCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413236    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198295.2-393s21c1
Sequence:CCGGGTATTGGTTCTCCAGTTAAAGCTCGAGCTTTAACTGGAGAACCAATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413952    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198295.2-1376s21c1
Sequence:CCGGGACACAGATGGAGGCTATATACTCGAGTATATAGCCTCCATCTGTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414247    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198295.2-1886s21c1
Sequence:CCGGAGTACTTTCACCTACTATATCCTCGAGGATATAGTAGGTGAAAGTACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124249    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198295.1-1210s1c1
Sequence:CCGGGCCAGATCATTGTATCAATTACTCGAGTAATTGATACAATGATCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124250    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_198295.1-565s1c1
Sequence:CCGGCCAACAATAGTTGTACTGAATCTCGAGATTCAGTACAACTATTGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124253    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198295.1-766s1c1
Sequence:CCGGTCTCCACTTATGGGCTGCTTTCTCGAGAAAGCAGCCCATAAGTGGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124252    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_198295.1-432s1c1
Sequence:CCGGGCATACCAGATTAAAGTCAATCTCGAGATTGACTTTAATCTGGTATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124251    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198295.1-336s1c1
Sequence:CCGGCTACCTTACTATGGATGGTTTCTCGAGAAACCATCCATAGTAAGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198295
VALIDATED
TMX3 MISSION shRNA Lentiviral Transduction Particles
thioredoxin-related transmembrane protein 3
Mouse
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000436730    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198295.2-744s21c1
Sequence:CCGGCTGAGTACGTGACGCTGAAAGCTCGAGCTTTCAGCGTCACGTACTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430672    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198295.2-616s21c1
Sequence:CCGGACGGAAGAGGCACCGTGTATTCTCGAGAATACACGGTGCCTCTTCCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418806    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198295.2-1400s21c1
Sequence:CCGGGAACGATATGAAGTATCTAAACTCGAGTTTAGATACTTCATATCGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414545    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198295.2-526s21c1
Sequence:CCGGACGGACTAAAGATGATATAATCTCGAGATTATATCATCTTTAGTCCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413236    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198295.2-393s21c1
Sequence:CCGGGTATTGGTTCTCCAGTTAAAGCTCGAGCTTTAACTGGAGAACCAATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413952    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198295.2-1376s21c1
Sequence:CCGGGACACAGATGGAGGCTATATACTCGAGTATATAGCCTCCATCTGTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414247    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198295.2-1886s21c1
Sequence:CCGGAGTACTTTCACCTACTATATCCTCGAGGATATAGTAGGTGAAAGTACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124249    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198295.1-1210s1c1
Sequence:CCGGGCCAGATCATTGTATCAATTACTCGAGTAATTGATACAATGATCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124250    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_198295.1-565s1c1
Sequence:CCGGCCAACAATAGTTGTACTGAATCTCGAGATTCAGTACAACTATTGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124253    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198295.1-766s1c1
Sequence:CCGGTCTCCACTTATGGGCTGCTTTCTCGAGAAAGCAGCCCATAAGTGGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124252    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_198295.1-432s1c1
Sequence:CCGGGCATACCAGATTAAAGTCAATCTCGAGATTGACTTTAATCTGGTATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124251    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198295.1-336s1c1
Sequence:CCGGCTACCTTACTATGGATGGTTTCTCGAGAAACCATCCATAGTAAGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019022
VALIDATED
TMX3 MISSION shRNA Bacterial Glycerol Stock
thioredoxin-related transmembrane protein 3
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000416002    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019022.3-1950s21c1
Sequence:CCGGCACTTTAAGGAGAACTAATAACTCGAGTTATTAGTTCTCCTTAAAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433224    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019022.3-1981s21c1
Sequence:CCGGGTATCAAGATTATGAGGTTAACTCGAGTTAACCTCATAATCTTGATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054307    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019022.3-922s1c1
Sequence:CCGGCATACCAGATTGAAGTCAATTCTCGAGAATTGACTTCAATCTGGTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054306    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_019022.3-385s1c1
Sequence:CCGGGCTACTTCCTATTCTAGCATTCTCGAGAATGCTAGAATAGGAAGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054305    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_019022.3-1054s1c1
Sequence:CCGGCCAACTGTAGTTGTACTGAATCTCGAGATTCAGTACAACTACAGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054303    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_019022.3-176s1c1
Sequence:CCGGCCACAGTTGTTGTACTTGATACTCGAGTATCAAGTACAACAACTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054304    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_019022.3-1331s1c1
Sequence:CCGGCCGACACAGATGGAGGTTATACTCGAGTATAACCTCCATCTGTGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019022
VALIDATED
TMX3 MISSION shRNA shRNA Plasmid DNA
thioredoxin-related transmembrane protein 3
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000416002    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019022.3-1950s21c1
Sequence:CCGGCACTTTAAGGAGAACTAATAACTCGAGTTATTAGTTCTCCTTAAAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433224    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019022.3-1981s21c1
Sequence:CCGGGTATCAAGATTATGAGGTTAACTCGAGTTAACCTCATAATCTTGATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054307    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019022.3-922s1c1
Sequence:CCGGCATACCAGATTGAAGTCAATTCTCGAGAATTGACTTCAATCTGGTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054306    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_019022.3-385s1c1
Sequence:CCGGGCTACTTCCTATTCTAGCATTCTCGAGAATGCTAGAATAGGAAGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054305    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_019022.3-1054s1c1
Sequence:CCGGCCAACTGTAGTTGTACTGAATCTCGAGATTCAGTACAACTACAGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054303    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_019022.3-176s1c1
Sequence:CCGGCCACAGTTGTTGTACTTGATACTCGAGTATCAAGTACAACAACTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054304    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_019022.3-1331s1c1
Sequence:CCGGCCGACACAGATGGAGGTTATACTCGAGTATAACCTCCATCTGTGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019022
VALIDATED
TMX3 MISSION shRNA Lentiviral Transduction Particles
thioredoxin-related transmembrane protein 3
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000416002    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019022.3-1950s21c1
Sequence:CCGGCACTTTAAGGAGAACTAATAACTCGAGTTATTAGTTCTCCTTAAAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433224    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019022.3-1981s21c1
Sequence:CCGGGTATCAAGATTATGAGGTTAACTCGAGTTAACCTCATAATCTTGATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054307    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019022.3-922s1c1
Sequence:CCGGCATACCAGATTGAAGTCAATTCTCGAGAATTGACTTCAATCTGGTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054306    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_019022.3-385s1c1
Sequence:CCGGGCTACTTCCTATTCTAGCATTCTCGAGAATGCTAGAATAGGAAGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054305    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_019022.3-1054s1c1
Sequence:CCGGCCAACTGTAGTTGTACTGAATCTCGAGATTCAGTACAACTACAGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054303    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_019022.3-176s1c1
Sequence:CCGGCCACAGTTGTTGTACTTGATACTCGAGTATCAAGTACAACAACTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054304    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_019022.3-1331s1c1
Sequence:CCGGCCGACACAGATGGAGGTTATACTCGAGTATAACCTCCATCTGTGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks