EMAIL THIS PAGE TO A FRIEND

TMX4

thioredoxin-related transmembrane protein 4

Synonyms: DJ971N18.2 PDIA14 TXNDC13
UniProtKB ID: Q9H1E5, Q8N4P7, Q8NCC1, Q9UJA1, Q9ULQ8
Gene ID:
Mouse(52837) thioredoxin-related transmembrane protein 4
Rat(296182) thioredoxin-related transmembrane protein 4
naked mole-rat(101725104) thioredoxin-related transmembrane protein 4
domestic guinea pig(100731871) thioredoxin-related transmembrane protein 4
cow(618015) thioredoxin-related transmembrane protein 4
sheep(101103340) thioredoxin-related transmembrane protein 4
Zebrafish(792311) thioredoxin-related transmembrane protein 4
domestic cat(101092020) thioredoxin-related transmembrane protein 4
dog(477161) thioredoxin-related transmembrane protein 4
chicken(416729) thioredoxin-related transmembrane protein 4
171 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_021156 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_021156 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_021156 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_029148 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029148 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029148 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_021156 Rosetta Predictions human pricing
XM_001081259 Rosetta Predictions rat pricing
XM_215853 Rosetta Predictions rat pricing
NM_029148 Rosetta Predictions mouse pricing
XM_130523 Rosetta Predictions mouse pricing
XM_902134 Rosetta Predictions mouse pricing
XM_902137 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021156 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00226065 predicted 1421
2 SASI_Hs01_00226066 predicted 420
3 SASI_Hs01_00226067 predicted 335
4 SASI_Hs02_00354699 predicted 1381
5 SASI_Hs01_00226068 predicted 1237
6 SASI_Hs01_00226069 predicted 1318
7 SASI_Hs02_00354700 predicted 1349
8 SASI_Hs01_00226070 predicted 487
9 SASI_Hs01_00226071 predicted 1563
10 SASI_Hs01_00226072 predicted 1361
11 SASI_Hs01_00226073 predicted 1279
12 SASI_Hs01_00226074 predicted 1335
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001081259 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00371265 predicted 363
2 SASI_Rn02_00371266 predicted 919
3 SASI_Rn02_00371267 predicted 762
4 SASI_Rn02_00371268 predicted 730
5 SASI_Rn02_00371269 predicted 1421
6 SASI_Rn02_00371270 predicted 1455
7 SASI_Rn02_00371271 predicted 562
8 SASI_Rn02_00371272 predicted 444
9 SASI_Rn02_00371273 predicted 530
10 SASI_Rn02_00371274 predicted 889
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_215853 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00376254 predicted 363
2 SASI_Rn02_00376255 predicted 915
3 SASI_Rn02_00376256 predicted 755
4 SASI_Rn02_00376257 predicted 727
5 SASI_Rn02_00376258 predicted 1418
6 SASI_Rn02_00376259 predicted 1457
7 SASI_Rn02_00376260 predicted 560
8 SASI_Rn02_00376261 predicted 444
9 SASI_Rn02_00376262 predicted 526
10 SASI_Rn02_00376263 predicted 892
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029148 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00334947 predicted 396
2 SASI_Mm02_00334948 predicted 1193
3 SASI_Mm02_00334949 predicted 1180
4 SASI_Mm02_00334950 predicted 640
5 SASI_Mm02_00334951 predicted 506
6 SASI_Mm02_00334952 predicted 1109
7 SASI_Mm02_00334953 predicted 673
8 SASI_Mm02_00334954 predicted 497
9 SASI_Mm02_00334955 predicted 362
10 SASI_Mm02_00334956 predicted 1223
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_130523 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00231682 predicted 754
2 SASI_Mm01_00231683 predicted 1550
3 SASI_Mm01_00231684 predicted 670
4 SASI_Mm01_00231685 predicted 1548
5 SASI_Mm01_00231686 predicted 999
6 SASI_Mm01_00231687 predicted 845
7 SASI_Mm01_00231688 predicted 1529
8 SASI_Mm01_00231689 predicted 1666
9 SASI_Mm01_00231690 predicted 877
10 SASI_Mm01_00231691 predicted 855
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_902134 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00204915 predicted 750
2 SASI_Mm01_00204916 predicted 674
3 SASI_Mm01_00204917 predicted 588
4 SASI_Mm01_00204918 predicted 760
5 SASI_Mm01_00204919 predicted 653
6 SASI_Mm01_00204920 predicted 723
7 SASI_Mm01_00204921 predicted 758
8 SASI_Mm01_00204922 predicted 751
9 SASI_Mm01_00204923 predicted 668
10 SASI_Mm01_00204924 predicted 608
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_902137 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00274635 predicted 760
2 SASI_Mm01_00274636 predicted 827
3 SASI_Mm01_00274637 predicted 838
4 SASI_Mm01_00274638 predicted 870
5 SASI_Mm01_00274639 predicted 659
6 SASI_Mm01_00274640 predicted 753
7 SASI_Mm01_00274641 predicted 859
8 SASI_Mm01_00274642 predicted 727
9 SASI_Mm01_00274643 predicted 810
10 SASI_Mm01_00274644 predicted 674
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021156
TMX4 MISSION shRNA Bacterial Glycerol Stock
thioredoxin-related transmembrane protein 4
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000064038    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021156.2-479s1c1
Sequence:CCGGGATGGGATATTCCGCCGTTATCTCGAGATAACGGCGGAATATCCCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064039    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021156.2-686s1c1
Sequence:CCGGGCTTGGTGTTCTTATGTGTTTCTCGAGAAACACATAAGAACACCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064040    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021156.2-333s1c1
Sequence:CCGGGCCAGCAGACTGATTCAGAATCTCGAGATTCTGAATCAGTCTGCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064042    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021156.2-914s1c1
Sequence:CCGGGTAGATGATGAAGAAGAGAAACTCGAGTTTCTCTTCTTCATCATCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064041    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021156.2-789s1c1
Sequence:CCGGCAAGGCATTTATCTGAGCGTTCTCGAGAACGCTCAGATAAATGCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000437681    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021156.2-1136s21c1
Sequence:CCGGGACTCCTTGAGGCAGCGTAAACTCGAGTTTACGCTGCCTCAAGGAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424210    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021156.2-1247s21c1
Sequence:CCGGGTTTGTACCAAATCCTTAATTCTCGAGAATTAAGGATTTGGTACAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021156
TMX4 MISSION shRNA shRNA Plasmid DNA
thioredoxin-related transmembrane protein 4
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000064038    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021156.2-479s1c1
Sequence:CCGGGATGGGATATTCCGCCGTTATCTCGAGATAACGGCGGAATATCCCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064039    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021156.2-686s1c1
Sequence:CCGGGCTTGGTGTTCTTATGTGTTTCTCGAGAAACACATAAGAACACCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064040    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021156.2-333s1c1
Sequence:CCGGGCCAGCAGACTGATTCAGAATCTCGAGATTCTGAATCAGTCTGCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064042    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021156.2-914s1c1
Sequence:CCGGGTAGATGATGAAGAAGAGAAACTCGAGTTTCTCTTCTTCATCATCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064041    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021156.2-789s1c1
Sequence:CCGGCAAGGCATTTATCTGAGCGTTCTCGAGAACGCTCAGATAAATGCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000437681    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021156.2-1136s21c1
Sequence:CCGGGACTCCTTGAGGCAGCGTAAACTCGAGTTTACGCTGCCTCAAGGAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424210    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021156.2-1247s21c1
Sequence:CCGGGTTTGTACCAAATCCTTAATTCTCGAGAATTAAGGATTTGGTACAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021156
TMX4 MISSION shRNA Lentiviral Transduction Particles
thioredoxin-related transmembrane protein 4
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000064038    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021156.2-479s1c1
Sequence:CCGGGATGGGATATTCCGCCGTTATCTCGAGATAACGGCGGAATATCCCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064039    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021156.2-686s1c1
Sequence:CCGGGCTTGGTGTTCTTATGTGTTTCTCGAGAAACACATAAGAACACCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064040    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021156.2-333s1c1
Sequence:CCGGGCCAGCAGACTGATTCAGAATCTCGAGATTCTGAATCAGTCTGCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064042    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021156.2-914s1c1
Sequence:CCGGGTAGATGATGAAGAAGAGAAACTCGAGTTTCTCTTCTTCATCATCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064041    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021156.2-789s1c1
Sequence:CCGGCAAGGCATTTATCTGAGCGTTCTCGAGAACGCTCAGATAAATGCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000437681    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021156.2-1136s21c1
Sequence:CCGGGACTCCTTGAGGCAGCGTAAACTCGAGTTTACGCTGCCTCAAGGAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424210    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021156.2-1247s21c1
Sequence:CCGGGTTTGTACCAAATCCTTAATTCTCGAGAATTAAGGATTTGGTACAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029148
VALIDATED
TMX4 MISSION shRNA Bacterial Glycerol Stock
thioredoxin-related transmembrane protein 4
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000265666    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029148.1-1114s21c1
Sequence:CCGGAGGGATCTTAGGTTACATTATCTCGAGATAATGTAACCTAAGATCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000258201    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029148.1-261s21c1
Sequence:CCGGGGCGAGTGGATGCTGAAATTTCTCGAGAAATTTCAGCATCCACTCGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252324    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029148.1-595s21c1
Sequence:CCGGTTAGCATCTCTGGCAAGATTTCTCGAGAAATCTTGCCAGAGATGCTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252323    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029148.1-2342s21c1
Sequence:CCGGGCTATATGAAGGATGACTAAACTCGAGTTTAGTCATCCTTCATATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000265652    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029148.1-469s21c1
Sequence:CCGGACCGTGGTCCAGGAATCTATGCTCGAGCATAGATTCCTGGACCACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029148
VALIDATED
TMX4 MISSION shRNA shRNA Plasmid DNA
thioredoxin-related transmembrane protein 4
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000265666    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029148.1-1114s21c1
Sequence:CCGGAGGGATCTTAGGTTACATTATCTCGAGATAATGTAACCTAAGATCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000258201    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029148.1-261s21c1
Sequence:CCGGGGCGAGTGGATGCTGAAATTTCTCGAGAAATTTCAGCATCCACTCGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252324    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029148.1-595s21c1
Sequence:CCGGTTAGCATCTCTGGCAAGATTTCTCGAGAAATCTTGCCAGAGATGCTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252323    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029148.1-2342s21c1
Sequence:CCGGGCTATATGAAGGATGACTAAACTCGAGTTTAGTCATCCTTCATATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000265652    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029148.1-469s21c1
Sequence:CCGGACCGTGGTCCAGGAATCTATGCTCGAGCATAGATTCCTGGACCACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029148
VALIDATED
TMX4 MISSION shRNA Lentiviral Transduction Particles
thioredoxin-related transmembrane protein 4
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000265666    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029148.1-1114s21c1
Sequence:CCGGAGGGATCTTAGGTTACATTATCTCGAGATAATGTAACCTAAGATCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000258201    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029148.1-261s21c1
Sequence:CCGGGGCGAGTGGATGCTGAAATTTCTCGAGAAATTTCAGCATCCACTCGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252324    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029148.1-595s21c1
Sequence:CCGGTTAGCATCTCTGGCAAGATTTCTCGAGAAATCTTGCCAGAGATGCTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252323    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029148.1-2342s21c1
Sequence:CCGGGCTATATGAAGGATGACTAAACTCGAGTTTAGTCATCCTTCATATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000265652    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029148.1-469s21c1
Sequence:CCGGACCGTGGTCCAGGAATCTATGCTCGAGCATAGATTCCTGGACCACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks