EMAIL THIS PAGE TO A FRIEND

TNC

tenascin C

Synonyms: 150-225 DFNA56 GMEM GP HXB JI TN TN-C
Gene ID:
Human(3371) Summary: This gene encodes an extracellular matrix protein with a spatially and temporally restricted tissue distribution. This protein is homohexameric with disulfide-linked subunits, and contains multiple EGF-like and fibronectin type-III domains. It is implicated in guidance of migrating neurons as well as axons during development, synaptic plasticity, and neuronal regeneration. [provided by RefSeq, Jul 2011]
Mouse(21923) tenascin C
Rat(116640) tenascin C
cow(540664) tenascin C
sheep(101118337) tenascin C
fruit fly(42990) tenectin
Zebrafish(30037) tenascin C
Horse(100049835) tenascin C
dog(481689) tenascin C
chicken(396440) tenascin C
63 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_011607 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011607 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011607 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_002160 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002160 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002160 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002160 Rosetta Predictions human pricing
NM_053861 Rosetta Predictions rat pricing
NM_011607 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002160 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00029548 predicted 4029
2 SASI_Hs01_00029549 predicted 3654
3 SASI_Hs02_00333366 predicted 955
4 SASI_Hs01_00029551 predicted 2234
5 SASI_Hs02_00333367 predicted 6148
6 SASI_Hs01_00029552 predicted 4475
7 SASI_Hs02_00333368 predicted 2653
8 SASI_Hs02_00333369 predicted 1741
9 SASI_Hs02_00333370 predicted 1752
10 SASI_Hs01_00029555 predicted 5614
11 SASI_Hs01_00029550 predicted 5335
12 SASI_Hs01_00029553 predicted 3072
13 SASI_Hs01_00029554 predicted 1008
14 SASI_Hs01_00029556 predicted 6297
15 SASI_Hs01_00029557 predicted 3505
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053861 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00266725 predicted 4552
2 SASI_Rn02_00266726 predicted 4829
3 SASI_Rn02_00266727 predicted 3880
4 SASI_Rn02_00266728 predicted 2459
5 SASI_Rn02_00266729 predicted 1033
6 SASI_Rn02_00266730 predicted 3452
7 SASI_Rn02_00266731 predicted 3330
8 SASI_Rn02_00266732 predicted 3025
9 SASI_Rn02_00266733 predicted 3995
10 SASI_Rn02_00266734 predicted 5489
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011607 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00162477 predicted 2998
2 SASI_Mm01_00162478 predicted 4630
3 SASI_Mm01_00162479 predicted 3954
4 SASI_Mm01_00162480 predicted 5321
5 SASI_Mm01_00162481 predicted 5570
6 SASI_Mm01_00162482 predicted 728
7 SASI_Mm02_00321033 predicted 6095
8 SASI_Mm01_00162483 predicted 3111
9 SASI_Mm01_00162484 predicted 4086
10 SASI_Mm01_00162486 predicted 4195
11 SASI_Mm01_00162485 predicted 2884
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011607
VALIDATED
TNC MISSION shRNA Bacterial Glycerol Stock
tenascin C
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000349876    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011607.2-6168s21c1
Sequence:CCGGCAGGCGTAAGCGGGCATAAATCTCGAGATTTATGCCCGCTTACGCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000349824    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011607.2-2069s21c1
Sequence:CCGGGGGTCACTGAGTACCTCATTACTCGAGTAATGAGGTACTCAGTGACCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000312137    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011607.2-2995s21c1
Sequence:CCGGCCCGGAACTGAATATGGGATTCTCGAGAATCCCATATTCAGTTCCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000312138    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011607.2-6250s21c1
Sequence:CCGGGCATCAACACAACCAGTCTAACTCGAGTTAGACTGGTTGTGTTGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000313073    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011607.2-2342s21c1
Sequence:CCGGTCGAAACATGGGAGATCATTTCTCGAGAAATGATCTCCCATGTTTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110735    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011607.1-6249s1c1
Sequence:CCGGGCATCAACACAACCAGTCTAACTCGAGTTAGACTGGTTGTGTTGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110739    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011607.1-2995s1c1
Sequence:CCGGCCCGGAACTGAATATGGGATTCTCGAGAATCCCATATTCAGTTCCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110738    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011607.1-5991s1c1
Sequence:CCGGCCTGTCCTACAAAGGAGCTTTCTCGAGAAAGCTCCTTTGTAGGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110736    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011607.1-2542s1c1
Sequence:CCGGCCCAGCCATATTGAGGTGAAACTCGAGTTTCACCTCAATATGGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110737    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011607.1-4800s1c1
Sequence:CCGGCCGGATCACTTATGTACCTATCTCGAGATAGGTACATAAGTGATCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011607
VALIDATED
TNC MISSION shRNA shRNA Plasmid DNA
tenascin C
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000349876    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011607.2-6168s21c1
Sequence:CCGGCAGGCGTAAGCGGGCATAAATCTCGAGATTTATGCCCGCTTACGCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000349824    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011607.2-2069s21c1
Sequence:CCGGGGGTCACTGAGTACCTCATTACTCGAGTAATGAGGTACTCAGTGACCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000312137    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011607.2-2995s21c1
Sequence:CCGGCCCGGAACTGAATATGGGATTCTCGAGAATCCCATATTCAGTTCCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000312138    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011607.2-6250s21c1
Sequence:CCGGGCATCAACACAACCAGTCTAACTCGAGTTAGACTGGTTGTGTTGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000313073    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011607.2-2342s21c1
Sequence:CCGGTCGAAACATGGGAGATCATTTCTCGAGAAATGATCTCCCATGTTTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110735    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011607.1-6249s1c1
Sequence:CCGGGCATCAACACAACCAGTCTAACTCGAGTTAGACTGGTTGTGTTGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110739    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011607.1-2995s1c1
Sequence:CCGGCCCGGAACTGAATATGGGATTCTCGAGAATCCCATATTCAGTTCCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110738    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011607.1-5991s1c1
Sequence:CCGGCCTGTCCTACAAAGGAGCTTTCTCGAGAAAGCTCCTTTGTAGGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110736    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011607.1-2542s1c1
Sequence:CCGGCCCAGCCATATTGAGGTGAAACTCGAGTTTCACCTCAATATGGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110737    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011607.1-4800s1c1
Sequence:CCGGCCGGATCACTTATGTACCTATCTCGAGATAGGTACATAAGTGATCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011607
VALIDATED
TNC MISSION shRNA Lentiviral Transduction Particles
tenascin C
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000349876    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011607.2-6168s21c1
Sequence:CCGGCAGGCGTAAGCGGGCATAAATCTCGAGATTTATGCCCGCTTACGCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000349824    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011607.2-2069s21c1
Sequence:CCGGGGGTCACTGAGTACCTCATTACTCGAGTAATGAGGTACTCAGTGACCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000312137    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011607.2-2995s21c1
Sequence:CCGGCCCGGAACTGAATATGGGATTCTCGAGAATCCCATATTCAGTTCCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000312138    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011607.2-6250s21c1
Sequence:CCGGGCATCAACACAACCAGTCTAACTCGAGTTAGACTGGTTGTGTTGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000313073    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011607.2-2342s21c1
Sequence:CCGGTCGAAACATGGGAGATCATTTCTCGAGAAATGATCTCCCATGTTTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110735    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011607.1-6249s1c1
Sequence:CCGGGCATCAACACAACCAGTCTAACTCGAGTTAGACTGGTTGTGTTGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110739    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011607.1-2995s1c1
Sequence:CCGGCCCGGAACTGAATATGGGATTCTCGAGAATCCCATATTCAGTTCCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110738    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011607.1-5991s1c1
Sequence:CCGGCCTGTCCTACAAAGGAGCTTTCTCGAGAAAGCTCCTTTGTAGGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110736    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011607.1-2542s1c1
Sequence:CCGGCCCAGCCATATTGAGGTGAAACTCGAGTTTCACCTCAATATGGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110737    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011607.1-4800s1c1
Sequence:CCGGCCGGATCACTTATGTACCTATCTCGAGATAGGTACATAAGTGATCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002160
VALIDATED
TNC MISSION shRNA Bacterial Glycerol Stock
tenascin C
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000230786    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002160.2-4963s21c1
Sequence:CCGGACCTAACCATTTCCGACATTACTCGAGTAATGTCGGAAATGGTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230788    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_002160.2-7218s21c1
Sequence:CCGGCCAGTGACAACATCGCAATAGCTCGAGCTATTGCGATGTTGTCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218684    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002160.2-5407s21c1
Sequence:GTACCGGAGGCTACTGAATACGAAATTGCTCGAGCAATTTCGTATTCAGTAGCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230787    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_002160.2-6950s21c1
Sequence:CCGGCAGGCGCAAACGGGCATAAATCTCGAGATTTATGCCCGTTTGCGCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230785    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_002160.2-2420s21c1
Sequence:CCGGGGAGTACTTTATCCGTGTATTCTCGAGAATACACGGATAAAGTACTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157942    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002160.1-6835s1c1
Sequence:CCGGCCACGAACACTCAATCCAGTTCTCGAGAACTGGATTGAGTGTTCGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157797    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002160.1-452s1c1
Sequence:CCGGCCAGTGGTGTTTAACCACGTTCTCGAGAACGTGGTTAAACACCACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157688    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002160.1-3000s1c1
Sequence:CCGGCCAGGAATCTTCGACGTGTTTCTCGAGAAACACGTCGAAGATTCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157798    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002160.1-5892s1c1
Sequence:CCGGCCACGGAATACACACTGAGAACTCGAGTTCTCAGTGTGTATTCCGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156613    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002160.1-6985s1c1
Sequence:CCGGGCATCAATACAACCAGCCCAACTCGAGTTGGGCTGGTTGTATTGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154001    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002160.1-5300s1c1
Sequence:CCGGCCACTGGAAATAACCCTACTTCTCGAGAAGTAGGGTTATTTCCAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152185    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002160.1-4915s1c1
Sequence:CCGGCCTAACCATTTCCGACATTAACTCGAGTTAATGTCGGAAATGGTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002160
VALIDATED
TNC MISSION shRNA shRNA Plasmid DNA
tenascin C
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000230786    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002160.2-4963s21c1
Sequence:CCGGACCTAACCATTTCCGACATTACTCGAGTAATGTCGGAAATGGTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230788    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_002160.2-7218s21c1
Sequence:CCGGCCAGTGACAACATCGCAATAGCTCGAGCTATTGCGATGTTGTCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218684    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002160.2-5407s21c1
Sequence:GTACCGGAGGCTACTGAATACGAAATTGCTCGAGCAATTTCGTATTCAGTAGCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230787    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_002160.2-6950s21c1
Sequence:CCGGCAGGCGCAAACGGGCATAAATCTCGAGATTTATGCCCGTTTGCGCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230785    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_002160.2-2420s21c1
Sequence:CCGGGGAGTACTTTATCCGTGTATTCTCGAGAATACACGGATAAAGTACTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157942    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002160.1-6835s1c1
Sequence:CCGGCCACGAACACTCAATCCAGTTCTCGAGAACTGGATTGAGTGTTCGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157797    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002160.1-452s1c1
Sequence:CCGGCCAGTGGTGTTTAACCACGTTCTCGAGAACGTGGTTAAACACCACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157688    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002160.1-3000s1c1
Sequence:CCGGCCAGGAATCTTCGACGTGTTTCTCGAGAAACACGTCGAAGATTCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157798    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002160.1-5892s1c1
Sequence:CCGGCCACGGAATACACACTGAGAACTCGAGTTCTCAGTGTGTATTCCGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156613    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002160.1-6985s1c1
Sequence:CCGGGCATCAATACAACCAGCCCAACTCGAGTTGGGCTGGTTGTATTGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154001    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002160.1-5300s1c1
Sequence:CCGGCCACTGGAAATAACCCTACTTCTCGAGAAGTAGGGTTATTTCCAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152185    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002160.1-4915s1c1
Sequence:CCGGCCTAACCATTTCCGACATTAACTCGAGTTAATGTCGGAAATGGTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002160
VALIDATED
TNC MISSION shRNA Lentiviral Transduction Particles
tenascin C
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000230786    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002160.2-4963s21c1
Sequence:CCGGACCTAACCATTTCCGACATTACTCGAGTAATGTCGGAAATGGTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230788    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_002160.2-7218s21c1
Sequence:CCGGCCAGTGACAACATCGCAATAGCTCGAGCTATTGCGATGTTGTCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218684    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002160.2-5407s21c1
Sequence:GTACCGGAGGCTACTGAATACGAAATTGCTCGAGCAATTTCGTATTCAGTAGCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230787    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_002160.2-6950s21c1
Sequence:CCGGCAGGCGCAAACGGGCATAAATCTCGAGATTTATGCCCGTTTGCGCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230785    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_002160.2-2420s21c1
Sequence:CCGGGGAGTACTTTATCCGTGTATTCTCGAGAATACACGGATAAAGTACTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157942    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002160.1-6835s1c1
Sequence:CCGGCCACGAACACTCAATCCAGTTCTCGAGAACTGGATTGAGTGTTCGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157797    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002160.1-452s1c1
Sequence:CCGGCCAGTGGTGTTTAACCACGTTCTCGAGAACGTGGTTAAACACCACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157688    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002160.1-3000s1c1
Sequence:CCGGCCAGGAATCTTCGACGTGTTTCTCGAGAAACACGTCGAAGATTCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157798    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002160.1-5892s1c1
Sequence:CCGGCCACGGAATACACACTGAGAACTCGAGTTCTCAGTGTGTATTCCGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156613    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002160.1-6985s1c1
Sequence:CCGGGCATCAATACAACCAGCCCAACTCGAGTTGGGCTGGTTGTATTGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154001    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002160.1-5300s1c1
Sequence:CCGGCCACTGGAAATAACCCTACTTCTCGAGAAGTAGGGTTATTTCCAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152185    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002160.1-4915s1c1
Sequence:CCGGCCTAACCATTTCCGACATTAACTCGAGTTAATGTCGGAAATGGTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks