EMAIL THIS PAGE TO A FRIEND

TNF

tumor necrosis factor

Synonyms: DIF TNF-alpha TNFA TNFSF2
UniProtKB ID: P01375, O43647, Q9P1Q2, Q9UIV3
Gene ID:
Human(7124) Summary: This gene encodes a multifunctional proinflammatory cytokine that belongs to the tumor necrosis factor (TNF) superfamily. This cytokine is mainly secreted by macrophages. It can bind to, and thus functions through its receptors TNFRSF1A/TNFR1 and TNFRSF1B/TNFBR. This cytokine is involved in the regulation of a wide spectrum of biological processes including cell proliferation, differentiation, apoptosis, lipid metabolism, and coagulation. This cytokine has been implicated in a variety of diseases, including autoimmune diseases, insulin resistance, and cancer. Knockout studies in mice also suggested the neuroprotective function of this cytokine. [provided by RefSeq, Jul 2008]
Mouse(21926) tumor necrosis factor
Rat(24835) tumor necrosis factor
cow(280943) tumor necrosis factor
sheep(443540) tumor necrosis factor
Goat(100861232) tumor necrosis factor alpha
Domestic Rabbit(100009088) tumor necrosis factor
naked mole-rat(101718432) tumor necrosis factor
domestic guinea pig(100135630) tumor necrosis factor
Horse(100033834) tumor necrosis factor
domestic cat(493755) tumor necrosis factor
dog(403922) tumor necrosis factor
Gene Class: Cytokines_and_Chemokines
198 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4502982 Anti-TNFA antibody produced in rabbit affinity isolated antibody human, mouse, rat
immunofluorescence, immunohistochemistry pricing
T2440 Anti-Tumor Necrosis Factor Soluble Receptor II antibody produced in goat affinity isolated antibody, lyophilized powder mouse
ELISA, western blot pricing
T2315 Anti-Tumor Necrosis Factor Soluble Receptor Type II antibody produced in goat IgG fraction of antiserum, lyophilized powder human
immunocytochemistry, western blot pricing
GW10844F Anti-Tumor Necrosis Factor-α antibody produced in chicken affinity isolated antibody, buffered aqueous solution human
ELISA, western blot pricing
T0813 Anti-Tumor Necrosis Factor-α antibody produced in goat affinity isolated antibody, lyophilized powder human
immunohistochemistry, neutralization, western blot pricing
T0938 Anti-Tumor Necrosis Factor-α antibody produced in goat affinity isolated antibody, lyophilized powder mouse
ELISA, flow cytometry, immunofluorescence, neutralization, western blot pricing
T8300 Anti-Tumor Necrosis Factor-α antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
dot blot, microarray, neutralization pricing
WH0007124M2 Monoclonal Anti-TNF antibody produced in mouse clone 1C3-A1-F4, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1404480 Monoclonal Anti-TNF antibody produced in mouse clone M1-C4, purified immunoglobulin, buffered aqueous solution human
ELISA, immunohistochemistry, western blot pricing
T1815 Monoclonal Anti-Tumor Necrosis Factor Receptor II antibody produced in mouse clone 22221, purified immunoglobulin, lyophilized powder human
immunocytochemistry, microarray, neutralization pricing
T2824 Monoclonal Anti-Tumor Necrosis Factor-α antibody produced in hamster ~2 mg/mL, clone TN3-19.12, purified immunoglobulin, buffered aqueous solution mouse, rat
ELISA, immunoprecipitation, microarray, neutralization, western blot pricing
T3198 Monoclonal Anti-Tumor Necrosis Factor-α antibody produced in mouse clone 45418.111, purified immunoglobulin, lyophilized powder rat
ELISA, neutralization, western blot pricing
T6817 Monoclonal Anti-Tumor Necrosis Factor-α antibody produced in mouse clone 28401, purified immunoglobulin, lyophilized powder human
ELISA, immunohistochemistry, neutralization, western blot pricing
F6651 Monoclonal Anti-Tumor Necrosis Factor-α–Fluorescein antibody produced in mouse clone 6402.31, purified immunoglobulin, buffered aqueous solution human
flow cytometry pricing

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0921 AQUA Peptide VNLLSAV[K] mouse pricing
AQ0917 AQUA Peptide FAISYQE[K] mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000594 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000594 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000594 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_013693 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013693 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013693 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU012051 MISSION® esiRNA esiRNA targeting mouse Tnf (esiRNA1) mouse pricing

Related Products

Product # Description Species Add to Cart
 
05-168 Anti-TNFα Antibody, clone MPG-XT3 1 mg, This Anti-TNFalpha Antibody, clone MPG-XT3 is validated for use in NEUT for the detection of TNFα. pricing
MABF351 Anti-TNF-α (human) Antibody, FITC, clone MAb11 100 tests, Anti-TNF apha Antibody, FITC, clone MAb11 is a highly specific mouse monoclonal antibody, that targets TNFα & has been tested in Flow Cytometry, IHC & Neutralizing. pricing
MABF352 Anti-TNF-α (human) Antibody, PE, clone MAb11 100 tests, Anti-TNF alpha Antibody, PE, clone MAb11 is a highly specific mouse monoclonal antibody, that targets TNFα & has been tested in Flow Cytometry, IHC & Neutralizing. pricing
AB1837P Anti-Tumor Necrosis Factor-α Antibody 50 µg, Anti-Tumor Necrosis Factor-α Antibody is an antibody against Tumor Necrosis Factor-α for use in ELISA & WB. pricing
AB2148P Anti-Tumor Necrosis Factor-α Antibody 100 µg, Detect Tumor Necrosis Factor-α using this Anti-Tumor Necrosis Factor-α Antibody validated for use in ELISA, NEUT & WB. pricing
MAB1096 Anti-Tumor Necrosis Factor-α Antibody, clone 195 200 µg, This Anti-Tumor Necrosis Factor-α Antibody, clone 195 is validated for use in IC, IH, NEUT, WB for the detection of Tumor Necrosis Factor-α. pricing
MAB1021 Anti-Tumor Necrosis Factor-α Antibody, clone 2C8 100 µg, Detect Tumor Necrosis Factor-α using this Anti-Tumor Necrosis Factor-α Antibody, clone 2C8 validated for use in ELISA, IH, NEUT. pricing
GF023 Tumor Necrosis Factor-α Protein, Recombinant human 50 µg, Tumor Necrosis Factor-alpha (TNF-alpha) is a potent lymphoid factor that exerts cytotoxic effects on a wide range of tumor cells & certain other target cells. pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000594 Rosetta Predictions human pricing
NM_012675 Rosetta Predictions rat pricing
NM_013693 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000594 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00011378 predicted 1018
2 SASI_Hs01_00011379 predicted 728
3 SASI_Hs01_00011380 predicted 421
4 SASI_Hs01_00011381 predicted 1065
5 SASI_Hs01_00011382 predicted 839
6 SASI_Hs01_00011383 predicted 733
7 SASI_Hs01_00011384 predicted 839
8 SASI_Hs01_00011385 predicted 826
9 SASI_Hs01_00011386 predicted 1040
10 SASI_Hs01_00011387 predicted 392
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012675 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00033334 predicted 495
2 SASI_Rn01_00033336 predicted 813
3 SASI_Rn01_00033337 predicted 984
4 SASI_Rn01_00033338 predicted 617
5 SASI_Rn01_00033339 predicted 855
6 SASI_Rn01_00033341 predicted 378
7 SASI_Rn01_00033342 predicted 336
8 SASI_Rn01_00033343 predicted 515
9 SASI_Rn02_00259959 predicted 783
10 SASI_Rn02_00259960 predicted 496
11 SASI_Rn01_00033335 predicted 283
12 SASI_Rn01_00033340 predicted 235
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013693 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00047023 predicted 862
2 SASI_Mm01_00047024 predicted 829
3 SASI_Mm02_00322582 predicted 980
4 SASI_Mm01_00047027 predicted 794
5 SASI_Mm01_00047028 predicted 867
6 SASI_Mm01_00047029 predicted 722
7 SASI_Mm01_00047030 predicted 391
8 SASI_Mm01_00047031 predicted 771
9 SASI_Mm01_00047032 predicted 343
10 SASI_Mm02_00322583 predicted 739
11 SASI_Mm01_00047025 predicted 868
12 SASI_Mm01_00047026 predicted 992
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000594
TNF MISSION shRNA Bacterial Glycerol Stock
tumor necrosis factor
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000003757    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000594.x-432s1c1
Sequence:CCGGCTGTAGCCCATGTTGTAGCAACTCGAGTTGCTACAACATGGGCTACAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003759    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000594.x-842s1c1
Sequence:CCGGCAGGTCTACTTTGGGATCATTCTCGAGAATGATCCCAAAGTAGACCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003758    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000594.x-841s1c1
Sequence:CCGGGCAGGTCTACTTTGGGATCATCTCGAGATGATCCCAAAGTAGACCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000355913    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000594.2-1298s21c1
Sequence:CCGGGGAGCCAGCTCCCTCTATTTACTCGAGTAAATAGAGGGAGCTGGCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000355911    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000594.2-789s21c1
Sequence:CCGGGACTCAGCGCTGAGATCAATCCTCGAGGATTGATCTCAGCGCTGAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000594
TNF MISSION shRNA shRNA Plasmid DNA
tumor necrosis factor
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000003757    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000594.x-432s1c1
Sequence:CCGGCTGTAGCCCATGTTGTAGCAACTCGAGTTGCTACAACATGGGCTACAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003759    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000594.x-842s1c1
Sequence:CCGGCAGGTCTACTTTGGGATCATTCTCGAGAATGATCCCAAAGTAGACCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003758    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000594.x-841s1c1
Sequence:CCGGGCAGGTCTACTTTGGGATCATCTCGAGATGATCCCAAAGTAGACCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000355913    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000594.2-1298s21c1
Sequence:CCGGGGAGCCAGCTCCCTCTATTTACTCGAGTAAATAGAGGGAGCTGGCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000355911    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000594.2-789s21c1
Sequence:CCGGGACTCAGCGCTGAGATCAATCCTCGAGGATTGATCTCAGCGCTGAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000594
TNF MISSION shRNA Lentiviral Transduction Particles
tumor necrosis factor
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000003757    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000594.x-432s1c1
Sequence:CCGGCTGTAGCCCATGTTGTAGCAACTCGAGTTGCTACAACATGGGCTACAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003759    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000594.x-842s1c1
Sequence:CCGGCAGGTCTACTTTGGGATCATTCTCGAGAATGATCCCAAAGTAGACCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003758    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000594.x-841s1c1
Sequence:CCGGGCAGGTCTACTTTGGGATCATCTCGAGATGATCCCAAAGTAGACCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000355913    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000594.2-1298s21c1
Sequence:CCGGGGAGCCAGCTCCCTCTATTTACTCGAGTAAATAGAGGGAGCTGGCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000355911    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000594.2-789s21c1
Sequence:CCGGGACTCAGCGCTGAGATCAATCCTCGAGGATTGATCTCAGCGCTGAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013693
TNF MISSION shRNA Bacterial Glycerol Stock
tumor necrosis factor
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000066183    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013693.1-640s1c1
Sequence:CCGGGCTATCTCATACCAGGAGAAACTCGAGTTTCTCCTGGTATGAGATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066187    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013693.1-392s1c1
Sequence:CCGGCACTCAGATCATCTTCTCAAACTCGAGTTTGAGAAGATGATCTGAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066186    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013693.1-357s1c1
Sequence:CCGGCCTCCCTCTCATCAGTTCTATCTCGAGATAGAACTGATGAGAGGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066184    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013693.1-549s1c1
Sequence:CCGGCGATGGGTTGTACCTTGTCTACTCGAGTAGACAAGGTACAACCCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000362936    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013693.2-727s21c1
Sequence:CCGGCCCTGGTATGAGCCCATATACCTCGAGGTATATGGGCTCATACCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000362939    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013693.2-797s21c1
Sequence:CCGGTCAATCTGCCCAAGTACTTAGCTCGAGCTAAGTACTTGGGCAGATTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000362863    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013693.2-631s21c1
Sequence:CCGGAGCCGATTTGCTATCTCATACCTCGAGGTATGAGATAGCAAATCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000362937    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013693.2-1080s21c1
Sequence:CCGGACCACCATCAAGGACTCAAATCTCGAGATTTGAGTCCTTGATGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013693
TNF MISSION shRNA shRNA Plasmid DNA
tumor necrosis factor
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000066183    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013693.1-640s1c1
Sequence:CCGGGCTATCTCATACCAGGAGAAACTCGAGTTTCTCCTGGTATGAGATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066187    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013693.1-392s1c1
Sequence:CCGGCACTCAGATCATCTTCTCAAACTCGAGTTTGAGAAGATGATCTGAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066186    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013693.1-357s1c1
Sequence:CCGGCCTCCCTCTCATCAGTTCTATCTCGAGATAGAACTGATGAGAGGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066184    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013693.1-549s1c1
Sequence:CCGGCGATGGGTTGTACCTTGTCTACTCGAGTAGACAAGGTACAACCCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000362936    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013693.2-727s21c1
Sequence:CCGGCCCTGGTATGAGCCCATATACCTCGAGGTATATGGGCTCATACCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000362939    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013693.2-797s21c1
Sequence:CCGGTCAATCTGCCCAAGTACTTAGCTCGAGCTAAGTACTTGGGCAGATTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000362863    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013693.2-631s21c1
Sequence:CCGGAGCCGATTTGCTATCTCATACCTCGAGGTATGAGATAGCAAATCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000362937    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013693.2-1080s21c1
Sequence:CCGGACCACCATCAAGGACTCAAATCTCGAGATTTGAGTCCTTGATGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013693
TNF MISSION shRNA Lentiviral Transduction Particles
tumor necrosis factor
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000066183    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013693.1-640s1c1
Sequence:CCGGGCTATCTCATACCAGGAGAAACTCGAGTTTCTCCTGGTATGAGATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066187    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013693.1-392s1c1
Sequence:CCGGCACTCAGATCATCTTCTCAAACTCGAGTTTGAGAAGATGATCTGAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066186    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013693.1-357s1c1
Sequence:CCGGCCTCCCTCTCATCAGTTCTATCTCGAGATAGAACTGATGAGAGGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066184    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013693.1-549s1c1
Sequence:CCGGCGATGGGTTGTACCTTGTCTACTCGAGTAGACAAGGTACAACCCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000362936    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013693.2-727s21c1
Sequence:CCGGCCCTGGTATGAGCCCATATACCTCGAGGTATATGGGCTCATACCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000362939    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013693.2-797s21c1
Sequence:CCGGTCAATCTGCCCAAGTACTTAGCTCGAGCTAAGTACTTGGGCAGATTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000362863    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013693.2-631s21c1
Sequence:CCGGAGCCGATTTGCTATCTCATACCTCGAGGTATGAGATAGCAAATCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000362937    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013693.2-1080s21c1
Sequence:CCGGACCACCATCAAGGACTCAAATCTCGAGATTTGAGTCCTTGATGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks