EMAIL THIS PAGE TO A FRIEND

TNFAIP1

tumor necrosis factor, alpha-induced protein 1 (endothelial)

Synonyms: B12 B61 BTBD34 EDP1 hBACURD2
UniProtKB ID: Q13829, Q5TZQ1
Gene ID:
Human(7126) Summary: This gene was identified as a gene whose expression can be induced by the tumor necrosis factor alpha (TNF) in umbilical vein endothelial cells. Studies of a similar gene in mouse suggest that the expression of this gene is developmentally regulated in a tissue-specific manner. [provided by RefSeq, Jul 2008]
Mouse(21927) tumor necrosis factor, alpha-induced protein 1 (endothelial)
Rat(287543) tumor necrosis factor, alpha-induced protein 1 (endothelial)
Zebrafish(327399) tumor necrosis factor, alpha-induced protein 1 (endothelial)
chicken(417672) tumor necrosis factor, alpha-induced protein 1 (endothelial)
domestic cat(101101266) tumor necrosis factor, alpha-induced protein 1 (endothelial)
Horse(100058953) tumor necrosis factor, alpha-induced protein 1 (endothelial)
dog(491161) tumor necrosis factor, alpha-induced protein 1 (endothelial)
domestic guinea pig(100728236) tumor necrosis factor, alpha-induced protein 1 (endothelial)
naked mole-rat(101703773) tumor necrosis factor, alpha-induced protein 1 (endothelial)
Domestic Rabbit(100348427) tumor necrosis factor, alpha-induced protein 1 (endothelial)
cow(539674) tumor necrosis factor, alpha-induced protein 1 (endothelial)
sheep(101104160) tumor necrosis factor, alpha-induced protein 1 (endothelial)
160 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009395 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009395 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009395 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_021137 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_021137 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_021137 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_021137 Rosetta Predictions human pricing
NM_182950 Rosetta Predictions rat pricing
NM_009395 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021137 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00131786 predicted 935
2 SASI_Hs01_00131787 predicted 730
3 SASI_Hs01_00131788 predicted 1089
4 SASI_Hs01_00131789 predicted 1274
5 SASI_Hs01_00131790 predicted 271
6 SASI_Hs01_00131791 predicted 494
7 SASI_Hs01_00131792 predicted 881
8 SASI_Hs01_00131793 predicted 476
9 SASI_Hs01_00131794 predicted 1510
10 SASI_Hs02_00354660 predicted 423
11 SASI_Hs01_00131785 predicted 1620
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182950 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00071046 predicted 1017
2 SASI_Rn01_00071047 predicted 1163
3 SASI_Rn01_00071048 predicted 1063
4 SASI_Rn01_00071049 predicted 496
5 SASI_Rn01_00071050 predicted 323
6 SASI_Rn01_00071051 predicted 1324
7 SASI_Rn01_00071052 predicted 771
8 SASI_Rn01_00071053 predicted 1234
9 SASI_Rn01_00071054 predicted 575
10 SASI_Rn02_00269865 predicted 762
11 SASI_Rn01_00071055 predicted 501
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009395 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00028801 predicted 1012
2 SASI_Mm01_00028802 predicted 758
3 SASI_Mm01_00028803 predicted 1135
4 SASI_Mm01_00028804 predicted 1115
5 SASI_Mm02_00316017 predicted 970
6 SASI_Mm01_00028805 predicted 470
7 SASI_Mm01_00028807 predicted 752
8 SASI_Mm01_00028808 predicted 563
9 SASI_Mm01_00028809 predicted 946
10 SASI_Mm01_00028810 predicted 312
11 SASI_Mm01_00028806 predicted 523
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009395
VALIDATED
TNFAIP1 MISSION shRNA Bacterial Glycerol Stock
tumor necrosis factor, alpha-induced protein 1 (endothelial)
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000354012    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009395.4-675s21c1
Sequence:CCGGGCAGGACAAGAAAGACTCCTACTCGAGTAGGAGTCTTTCTTGTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000326136    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009395.4-1183s21c1
Sequence:CCGGCGCATTCATGTCAAGCGCTATCTCGAGATAGCGCTTGACATGAATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000326210    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009395.4-835s21c1
Sequence:CCGGCACCTGCTAAAGAACATTGAACTCGAGTTCAATGTTCTTTAGCAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000326135    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009395.4-3008s21c1
Sequence:CCGGCGCTGGAACTAAGATGACAATCTCGAGATTGTCATCTTAGTTCCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124411    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009395.2-772s1c1
Sequence:CCGGCCTGCTAAAGAACATTGAACTCTCGAGAGTTCAATGTTCTTTAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124409    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009395.2-2943s1c1
Sequence:CCGGCGCTGGAACTAAGATGACAATCTCGAGATTGTCATCTTAGTTCCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124410    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009395.2-1118s1c1
Sequence:CCGGCGCATTCATGTCAAGCGCTATCTCGAGATAGCGCTTGACATGAATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124412    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009395.2-610s1c1
Sequence:CCGGGCAGGACAAGAAAGACTCCTACTCGAGTAGGAGTCTTTCTTGTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124413    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009395.2-770s1c1
Sequence:CCGGCACCTGCTAAAGAACATTGAACTCGAGTTCAATGTTCTTTAGCAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009395
VALIDATED
TNFAIP1 MISSION shRNA shRNA Plasmid DNA
tumor necrosis factor, alpha-induced protein 1 (endothelial)
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000354012    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009395.4-675s21c1
Sequence:CCGGGCAGGACAAGAAAGACTCCTACTCGAGTAGGAGTCTTTCTTGTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000326136    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009395.4-1183s21c1
Sequence:CCGGCGCATTCATGTCAAGCGCTATCTCGAGATAGCGCTTGACATGAATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000326210    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009395.4-835s21c1
Sequence:CCGGCACCTGCTAAAGAACATTGAACTCGAGTTCAATGTTCTTTAGCAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000326135    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009395.4-3008s21c1
Sequence:CCGGCGCTGGAACTAAGATGACAATCTCGAGATTGTCATCTTAGTTCCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124411    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009395.2-772s1c1
Sequence:CCGGCCTGCTAAAGAACATTGAACTCTCGAGAGTTCAATGTTCTTTAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124409    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009395.2-2943s1c1
Sequence:CCGGCGCTGGAACTAAGATGACAATCTCGAGATTGTCATCTTAGTTCCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124410    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009395.2-1118s1c1
Sequence:CCGGCGCATTCATGTCAAGCGCTATCTCGAGATAGCGCTTGACATGAATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124412    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009395.2-610s1c1
Sequence:CCGGGCAGGACAAGAAAGACTCCTACTCGAGTAGGAGTCTTTCTTGTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124413    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009395.2-770s1c1
Sequence:CCGGCACCTGCTAAAGAACATTGAACTCGAGTTCAATGTTCTTTAGCAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009395
VALIDATED
TNFAIP1 MISSION shRNA Lentiviral Transduction Particles
tumor necrosis factor, alpha-induced protein 1 (endothelial)
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000354012    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009395.4-675s21c1
Sequence:CCGGGCAGGACAAGAAAGACTCCTACTCGAGTAGGAGTCTTTCTTGTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000326136    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009395.4-1183s21c1
Sequence:CCGGCGCATTCATGTCAAGCGCTATCTCGAGATAGCGCTTGACATGAATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000326210    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009395.4-835s21c1
Sequence:CCGGCACCTGCTAAAGAACATTGAACTCGAGTTCAATGTTCTTTAGCAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000326135    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009395.4-3008s21c1
Sequence:CCGGCGCTGGAACTAAGATGACAATCTCGAGATTGTCATCTTAGTTCCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124411    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009395.2-772s1c1
Sequence:CCGGCCTGCTAAAGAACATTGAACTCTCGAGAGTTCAATGTTCTTTAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124409    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009395.2-2943s1c1
Sequence:CCGGCGCTGGAACTAAGATGACAATCTCGAGATTGTCATCTTAGTTCCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124410    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009395.2-1118s1c1
Sequence:CCGGCGCATTCATGTCAAGCGCTATCTCGAGATAGCGCTTGACATGAATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124412    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009395.2-610s1c1
Sequence:CCGGGCAGGACAAGAAAGACTCCTACTCGAGTAGGAGTCTTTCTTGTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124413    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009395.2-770s1c1
Sequence:CCGGCACCTGCTAAAGAACATTGAACTCGAGTTCAATGTTCTTTAGCAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021137
TNFAIP1 MISSION shRNA Bacterial Glycerol Stock
tumor necrosis factor, alpha-induced protein 1 (endothelial)
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000319241    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021137.4-1037s21c1
Sequence:CCGGCGTGCTCTTCATCAAGGATGTCTCGAGACATCCTTGATGAAGAGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000319167    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021137.4-926s21c1
Sequence:CCGGGCTGCTGTACAACAGAAGCAACTCGAGTTGCTTCTGTTGTACAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000319170    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021137.4-2027s21c1
Sequence:CCGGCCCATGTCTTTCTACCCTAATCTCGAGATTAGGGTAGAAAGACATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000319242    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021137.4-1286s21c1
Sequence:CCGGCAGTGAAGATGAGGAGACCTTCTCGAGAAGGTCTCCTCATCTTCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158313    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021137.3-943s1c1
Sequence:CCGGCCGAATCTATGAGGAGACACTCTCGAGAGTGTCTCCTCATAGATTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157126    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021137.3-288s1c1
Sequence:CCGGGCAACAAGTATGTCCAGCTCACTCGAGTGAGCTGGACATACTTGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156906    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021137.3-688s1c1
Sequence:CCGGGCTGCTGTACAACAGAAGCAACTCGAGTTGCTTCTGTTGTACAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156467    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021137.3-1048s1c1
Sequence:CCGGCAGTGAAGATGAGGAGACCTTCTCGAGAAGGTCTCCTCATCTTCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156468    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021137.3-799s1c1
Sequence:CCGGCGTGCTCTTCATCAAGGATGTCTCGAGACATCCTTGATGAAGAGCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152432    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021137.3-1790s1c1
Sequence:CCGGCCCATGTCTTTCTACCCTAATCTCGAGATTAGGGTAGAAAGACATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152580    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021137.3-691s1c1
Sequence:CCGGGCTGTACAACAGAAGCAACAACTCGAGTTGTTGCTTCTGTTGTACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021137
TNFAIP1 MISSION shRNA shRNA Plasmid DNA
tumor necrosis factor, alpha-induced protein 1 (endothelial)
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000319241    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021137.4-1037s21c1
Sequence:CCGGCGTGCTCTTCATCAAGGATGTCTCGAGACATCCTTGATGAAGAGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000319167    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021137.4-926s21c1
Sequence:CCGGGCTGCTGTACAACAGAAGCAACTCGAGTTGCTTCTGTTGTACAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000319170    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021137.4-2027s21c1
Sequence:CCGGCCCATGTCTTTCTACCCTAATCTCGAGATTAGGGTAGAAAGACATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000319242    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021137.4-1286s21c1
Sequence:CCGGCAGTGAAGATGAGGAGACCTTCTCGAGAAGGTCTCCTCATCTTCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158313    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021137.3-943s1c1
Sequence:CCGGCCGAATCTATGAGGAGACACTCTCGAGAGTGTCTCCTCATAGATTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157126    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021137.3-288s1c1
Sequence:CCGGGCAACAAGTATGTCCAGCTCACTCGAGTGAGCTGGACATACTTGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156906    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021137.3-688s1c1
Sequence:CCGGGCTGCTGTACAACAGAAGCAACTCGAGTTGCTTCTGTTGTACAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156467    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021137.3-1048s1c1
Sequence:CCGGCAGTGAAGATGAGGAGACCTTCTCGAGAAGGTCTCCTCATCTTCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156468    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021137.3-799s1c1
Sequence:CCGGCGTGCTCTTCATCAAGGATGTCTCGAGACATCCTTGATGAAGAGCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152432    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021137.3-1790s1c1
Sequence:CCGGCCCATGTCTTTCTACCCTAATCTCGAGATTAGGGTAGAAAGACATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152580    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021137.3-691s1c1
Sequence:CCGGGCTGTACAACAGAAGCAACAACTCGAGTTGTTGCTTCTGTTGTACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021137
TNFAIP1 MISSION shRNA Lentiviral Transduction Particles
tumor necrosis factor, alpha-induced protein 1 (endothelial)
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000319241    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021137.4-1037s21c1
Sequence:CCGGCGTGCTCTTCATCAAGGATGTCTCGAGACATCCTTGATGAAGAGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000319167    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021137.4-926s21c1
Sequence:CCGGGCTGCTGTACAACAGAAGCAACTCGAGTTGCTTCTGTTGTACAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000319170    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021137.4-2027s21c1
Sequence:CCGGCCCATGTCTTTCTACCCTAATCTCGAGATTAGGGTAGAAAGACATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000319242    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021137.4-1286s21c1
Sequence:CCGGCAGTGAAGATGAGGAGACCTTCTCGAGAAGGTCTCCTCATCTTCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158313    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021137.3-943s1c1
Sequence:CCGGCCGAATCTATGAGGAGACACTCTCGAGAGTGTCTCCTCATAGATTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157126    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021137.3-288s1c1
Sequence:CCGGGCAACAAGTATGTCCAGCTCACTCGAGTGAGCTGGACATACTTGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156906    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021137.3-688s1c1
Sequence:CCGGGCTGCTGTACAACAGAAGCAACTCGAGTTGCTTCTGTTGTACAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156467    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021137.3-1048s1c1
Sequence:CCGGCAGTGAAGATGAGGAGACCTTCTCGAGAAGGTCTCCTCATCTTCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156468    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021137.3-799s1c1
Sequence:CCGGCGTGCTCTTCATCAAGGATGTCTCGAGACATCCTTGATGAAGAGCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152432    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021137.3-1790s1c1
Sequence:CCGGCCCATGTCTTTCTACCCTAATCTCGAGATTAGGGTAGAAAGACATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152580    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021137.3-691s1c1
Sequence:CCGGGCTGTACAACAGAAGCAACAACTCGAGTTGTTGCTTCTGTTGTACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks