EMAIL THIS PAGE TO A FRIEND

TNFAIP2

tumor necrosis factor, alpha-induced protein 2

Synonyms: B94 EXOC3L3
UniProtKB ID: Q03169, Q86VI0
Gene ID:
Human(7127) Summary: This gene was identified as a gene whose expression can be induced by the tumor necrosis factor alpha (TNF) in umbilical vein endothelial cells. The expression of this gene was shown to be induced by retinoic acid in a cell line expressing a oncogenic version of the retinoic acid receptor alpha fusion protein, which suggested that this gene may be a retinoic acid target gene in acute promyelocytic leukemia. [provided by RefSeq, Jul 2008]
Mouse(21928) tumor necrosis factor, alpha-induced protein 2
Rat(299339) tumor necrosis factor, alpha-induced protein 2
cow(786672) tumor necrosis factor, alpha-induced protein 2
sheep(101122983) tumor necrosis factor, alpha-induced protein 2
naked mole-rat(101715138) tumor necrosis factor, alpha-induced protein 2
domestic guinea pig(100735245) tumor necrosis factor, alpha-induced protein 2
chicken(423477) tumor necrosis factor, alpha-induced protein 2
dog(480440) tumor necrosis factor, alpha-induced protein 2
domestic cat(101084887) tumor necrosis factor, alpha-induced protein 2
98 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006291 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006291 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006291 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009396 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009396 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009396 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006291 Rosetta Predictions human pricing
XM_001071736 Rosetta Predictions rat pricing
XM_216791 Rosetta Predictions rat pricing
NM_009396 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006291 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00103107 predicted 2254
2 SASI_Hs02_00341282 predicted 1308
3 SASI_Hs01_00103108 predicted 1210
4 SASI_Hs01_00103109 predicted 1330
5 SASI_Hs01_00103110 predicted 1857
6 SASI_Hs01_00103111 predicted 2076
7 SASI_Hs01_00103113 predicted 1367
8 SASI_Hs01_00103114 predicted 1992
9 SASI_Hs01_00103115 predicted 2444
10 SASI_Hs02_00341283 predicted 2193
11 SASI_Hs01_00103112 predicted 2249
12 SASI_Hs01_00103116 predicted 1940
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001071736 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00336246 predicted 1366
2 SASI_Rn02_00336247 predicted 1774
3 SASI_Rn02_00336248 predicted 1244
4 SASI_Rn02_00336249 predicted 1090
5 SASI_Rn02_00336250 predicted 1984
6 SASI_Rn02_00336251 predicted 1211
7 SASI_Rn02_00336252 predicted 2092
8 SASI_Rn02_00336253 predicted 1442
9 SASI_Rn02_00336254 predicted 2110
10 SASI_Rn02_00336255 predicted 1910
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_216791 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00376857 predicted 1368
2 SASI_Rn02_00376858 predicted 1766
3 SASI_Rn02_00376859 predicted 1246
4 SASI_Rn02_00376860 predicted 1082
5 SASI_Rn02_00376861 predicted 1986
6 SASI_Rn02_00376862 predicted 1211
7 SASI_Rn02_00376863 predicted 2094
8 SASI_Rn02_00376864 predicted 1444
9 SASI_Rn02_00376865 predicted 2111
10 SASI_Rn02_00376866 predicted 1912
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009396 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00155437 predicted 1467
2 SASI_Mm01_00155438 predicted 1905
3 SASI_Mm01_00155439 predicted 1381
4 SASI_Mm01_00155440 predicted 1391
5 SASI_Mm01_00155442 predicted 2087
6 SASI_Mm01_00155444 predicted 1882
7 SASI_Mm01_00155445 predicted 1718
8 SASI_Mm01_00155446 predicted 1269
9 SASI_Mm02_00316018 predicted 1227
10 SASI_Mm02_00316019 predicted 2006
11 SASI_Mm01_00155441 predicted 1209
12 SASI_Mm01_00155443 predicted 1050
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006291
VALIDATED
TNFAIP2 MISSION shRNA Bacterial Glycerol Stock
tumor necrosis factor, alpha-induced protein 2
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000138492    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006291.2-266s1c1
Sequence:CCGGCGTCTTCACCAAAGGGAAGAACTCGAGTTCTTCCCTTTGGTGAAGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000133786    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006291.2-1340s1c1
Sequence:CCGGCGCCTTTAATGAATTTCTGGACTCGAGTCCAGAAATTCATTAAAGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134370    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006291.2-212s1c1
Sequence:CCGGGAAGAAGAAGAAGGAGAAGAACTCGAGTTCTTCTCCTTCTTCTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135229    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_006291.2-2998s1c1
Sequence:CCGGCCACAAACTTCGTGGATCAAACTCGAGTTTGATCCACGAAGTTTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135170    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_006291.2-269s1c1
Sequence:CCGGCTTCACCAAAGGGAAGAAGAACTCGAGTTCTTCTTCCCTTTGGTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000353651    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_006291.2-266s21c1
Sequence:CCGGCGTCTTCACCAAAGGGAAGAACTCGAGTTCTTCCCTTTGGTGAAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000330290    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 2 Clone ID:NM_006291.2-1912s21c1
Sequence:CCGGAGATTGAGGTGGCCACTTATGCTCGAGCATAAGTGGCCACCTCAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000330220    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_006291.2-1364s21c1
Sequence:CCGGAGGCAAGCAGCTGACGAATTACTCGAGTAATTCGTCAGCTGCTTGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000330288    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_006291.2-2998s21c1
Sequence:CCGGCCACAAACTTCGTGGATCAAACTCGAGTTTGATCCACGAAGTTTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000353652    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006291.2-1340s21c1
Sequence:CCGGCGCCTTTAATGAATTTCTGGACTCGAGTCCAGAAATTCATTAAAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006291
VALIDATED
TNFAIP2 MISSION shRNA shRNA Plasmid DNA
tumor necrosis factor, alpha-induced protein 2
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000138492    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006291.2-266s1c1
Sequence:CCGGCGTCTTCACCAAAGGGAAGAACTCGAGTTCTTCCCTTTGGTGAAGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000133786    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006291.2-1340s1c1
Sequence:CCGGCGCCTTTAATGAATTTCTGGACTCGAGTCCAGAAATTCATTAAAGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134370    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006291.2-212s1c1
Sequence:CCGGGAAGAAGAAGAAGGAGAAGAACTCGAGTTCTTCTCCTTCTTCTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135229    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_006291.2-2998s1c1
Sequence:CCGGCCACAAACTTCGTGGATCAAACTCGAGTTTGATCCACGAAGTTTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135170    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_006291.2-269s1c1
Sequence:CCGGCTTCACCAAAGGGAAGAAGAACTCGAGTTCTTCTTCCCTTTGGTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000353651    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_006291.2-266s21c1
Sequence:CCGGCGTCTTCACCAAAGGGAAGAACTCGAGTTCTTCCCTTTGGTGAAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000330290    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 2 Clone ID:NM_006291.2-1912s21c1
Sequence:CCGGAGATTGAGGTGGCCACTTATGCTCGAGCATAAGTGGCCACCTCAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000330220    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_006291.2-1364s21c1
Sequence:CCGGAGGCAAGCAGCTGACGAATTACTCGAGTAATTCGTCAGCTGCTTGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000330288    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_006291.2-2998s21c1
Sequence:CCGGCCACAAACTTCGTGGATCAAACTCGAGTTTGATCCACGAAGTTTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000353652    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006291.2-1340s21c1
Sequence:CCGGCGCCTTTAATGAATTTCTGGACTCGAGTCCAGAAATTCATTAAAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006291
VALIDATED
TNFAIP2 MISSION shRNA Lentiviral Transduction Particles
tumor necrosis factor, alpha-induced protein 2
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000138492    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006291.2-266s1c1
Sequence:CCGGCGTCTTCACCAAAGGGAAGAACTCGAGTTCTTCCCTTTGGTGAAGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000133786    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006291.2-1340s1c1
Sequence:CCGGCGCCTTTAATGAATTTCTGGACTCGAGTCCAGAAATTCATTAAAGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134370    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006291.2-212s1c1
Sequence:CCGGGAAGAAGAAGAAGGAGAAGAACTCGAGTTCTTCTCCTTCTTCTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135229    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_006291.2-2998s1c1
Sequence:CCGGCCACAAACTTCGTGGATCAAACTCGAGTTTGATCCACGAAGTTTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135170    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_006291.2-269s1c1
Sequence:CCGGCTTCACCAAAGGGAAGAAGAACTCGAGTTCTTCTTCCCTTTGGTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000353651    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_006291.2-266s21c1
Sequence:CCGGCGTCTTCACCAAAGGGAAGAACTCGAGTTCTTCCCTTTGGTGAAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000330290    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 2 Clone ID:NM_006291.2-1912s21c1
Sequence:CCGGAGATTGAGGTGGCCACTTATGCTCGAGCATAAGTGGCCACCTCAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000330220    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_006291.2-1364s21c1
Sequence:CCGGAGGCAAGCAGCTGACGAATTACTCGAGTAATTCGTCAGCTGCTTGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000330288    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_006291.2-2998s21c1
Sequence:CCGGCCACAAACTTCGTGGATCAAACTCGAGTTTGATCCACGAAGTTTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000353652    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006291.2-1340s21c1
Sequence:CCGGCGCCTTTAATGAATTTCTGGACTCGAGTCCAGAAATTCATTAAAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009396
VALIDATED
TNFAIP2 MISSION shRNA Bacterial Glycerol Stock
tumor necrosis factor, alpha-induced protein 2
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000106374    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009396.1-256s1c1
Sequence:CCGGCCCAGATTATCAGATCTGGAACTCGAGTTCCAGATCTGATAATCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000106372    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009396.1-1662s1c1
Sequence:CCGGGCACCTAGTGAAAGAATACATCTCGAGATGTATTCTTTCACTAGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000106373    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009396.1-1659s1c1
Sequence:CCGGCCTGCACCTAGTGAAAGAATACTCGAGTATTCTTTCACTAGGTGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000106371    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009396.1-1300s1c1
Sequence:CCGGCGCGCCTTTGATGAGTTTCTACTCGAGTAGAAACTCATCAAAGGCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000106370    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009396.1-2406s1c1
Sequence:CCGGCCTCATTTATACCATTTCCTTCTCGAGAAGGAAATGGTATAAATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000376086    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009396.2-1561s21c1
Sequence:CCGGTGGACCTGAAGCCGCTGTTTACTCGAGTAAACAGCGGCTTCAGGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000376020    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009396.2-2094s21c1
Sequence:CCGGTCCCTTATAAAGGTTACTTAGCTCGAGCTAAGTAACCTTTATAAGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000363854    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009396.2-1234s21c1
Sequence:CCGGTCGACATTCTCCAGATCATTTCTCGAGAAATGATCTGGAGAATGTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009396
VALIDATED
TNFAIP2 MISSION shRNA shRNA Plasmid DNA
tumor necrosis factor, alpha-induced protein 2
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000106374    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009396.1-256s1c1
Sequence:CCGGCCCAGATTATCAGATCTGGAACTCGAGTTCCAGATCTGATAATCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000106372    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009396.1-1662s1c1
Sequence:CCGGGCACCTAGTGAAAGAATACATCTCGAGATGTATTCTTTCACTAGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000106373    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009396.1-1659s1c1
Sequence:CCGGCCTGCACCTAGTGAAAGAATACTCGAGTATTCTTTCACTAGGTGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000106371    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009396.1-1300s1c1
Sequence:CCGGCGCGCCTTTGATGAGTTTCTACTCGAGTAGAAACTCATCAAAGGCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000106370    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009396.1-2406s1c1
Sequence:CCGGCCTCATTTATACCATTTCCTTCTCGAGAAGGAAATGGTATAAATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000376086    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009396.2-1561s21c1
Sequence:CCGGTGGACCTGAAGCCGCTGTTTACTCGAGTAAACAGCGGCTTCAGGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000376020    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009396.2-2094s21c1
Sequence:CCGGTCCCTTATAAAGGTTACTTAGCTCGAGCTAAGTAACCTTTATAAGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000363854    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009396.2-1234s21c1
Sequence:CCGGTCGACATTCTCCAGATCATTTCTCGAGAAATGATCTGGAGAATGTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009396
VALIDATED
TNFAIP2 MISSION shRNA Lentiviral Transduction Particles
tumor necrosis factor, alpha-induced protein 2
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000106374    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009396.1-256s1c1
Sequence:CCGGCCCAGATTATCAGATCTGGAACTCGAGTTCCAGATCTGATAATCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000106372    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009396.1-1662s1c1
Sequence:CCGGGCACCTAGTGAAAGAATACATCTCGAGATGTATTCTTTCACTAGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000106373    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009396.1-1659s1c1
Sequence:CCGGCCTGCACCTAGTGAAAGAATACTCGAGTATTCTTTCACTAGGTGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000106371    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009396.1-1300s1c1
Sequence:CCGGCGCGCCTTTGATGAGTTTCTACTCGAGTAGAAACTCATCAAAGGCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000106370    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009396.1-2406s1c1
Sequence:CCGGCCTCATTTATACCATTTCCTTCTCGAGAAGGAAATGGTATAAATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000376086    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009396.2-1561s21c1
Sequence:CCGGTGGACCTGAAGCCGCTGTTTACTCGAGTAAACAGCGGCTTCAGGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000376020    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009396.2-2094s21c1
Sequence:CCGGTCCCTTATAAAGGTTACTTAGCTCGAGCTAAGTAACCTTTATAAGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000363854    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009396.2-1234s21c1
Sequence:CCGGTCGACATTCTCCAGATCATTTCTCGAGAAATGATCTGGAGAATGTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks