EMAIL THIS PAGE TO A FRIEND

TNFAIP3

tumor necrosis factor, alpha-induced protein 3

Synonyms: A20 OTUD7C TNFA1P2
UniProtKB ID: P21580, B2R767, E1P588, Q2HIX9, Q5VXQ7, Q9NSR6
Gene ID:
Human(7128) Summary: This gene was identified as a gene whose expression is rapidly induced by the tumor necrosis factor (TNF). The protein encoded by this gene is a zinc finger protein and ubiqitin-editing enzyme, and has been shown to inhibit NF-kappa B activation as well as TNF-mediated apoptosis. The encoded protein, which has both ubiquitin ligase and deubiquitinase activities, is involved in the cytokine-mediated immune and inflammatory responses. Several transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2012]
Mouse(21929) tumor necrosis factor, alpha-induced protein 3
Rat(683206) tumor necrosis factor, alpha-induced protein 3
Zebrafish(564497) tumor necrosis factor, alpha-induced protein 3
Horse(100073197) tumor necrosis factor, alpha-induced protein 3
domestic cat(101083682) tumor necrosis factor, alpha-induced protein 3
dog(484006) tumor necrosis factor, alpha-induced protein 3
chicken(421684) tumor necrosis factor, alpha-induced protein 3
domestic guinea pig(100720503) tumor necrosis factor, alpha-induced protein 3
cow(508105) tumor necrosis factor, alpha-induced protein 3
sheep(101113156) tumor necrosis factor, alpha-induced protein 3
143 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009397 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009397 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009397 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_006290 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006290 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006290 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006290 Rosetta Predictions human pricing
XM_001060914 Rosetta Predictions rat pricing
XM_001060980 Rosetta Predictions rat pricing
NM_009397 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006290 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00033556 predicted 633
2 SASI_Hs01_00033557 predicted 1635
3 SASI_Hs01_00033558 predicted 2489
4 SASI_Hs02_00341281 predicted 749
5 SASI_Hs01_00033559 predicted 1940
6 SASI_Hs01_00033560 predicted 626
7 SASI_Hs01_00033561 predicted 468
8 SASI_Hs01_00033562 predicted 1253
9 SASI_Hs01_00033563 predicted 236
10 SASI_Hs01_00033564 predicted 2187
11 SASI_Hs01_00033565 predicted 1047
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001060914 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00298147 predicted 2177
2 SASI_Rn02_00298148 predicted 652
3 SASI_Rn02_00298149 predicted 392
4 SASI_Rn02_00298150 predicted 879
5 SASI_Rn02_00298151 predicted 1625
6 SASI_Rn02_00298152 predicted 1737
7 SASI_Rn02_00298153 predicted 1172
8 SASI_Rn02_00298154 predicted 2528
9 SASI_Rn02_00298155 predicted 2252
10 SASI_Rn02_00298156 predicted 233
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001060980 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00298336 predicted 2235
2 SASI_Rn02_00298337 predicted 707
3 SASI_Rn02_00298338 predicted 449
4 SASI_Rn02_00298339 predicted 933
5 SASI_Rn02_00298340 predicted 1687
6 SASI_Rn02_00298341 predicted 1798
7 SASI_Rn02_00298342 predicted 1224
8 SASI_Rn02_00298343 predicted 2586
9 SASI_Rn02_00298344 predicted 2303
10 SASI_Rn02_00298345 predicted 294
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009397 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00114521 predicted 361
2 SASI_Mm01_00114522 predicted 2048
3 SASI_Mm01_00114524 predicted 1363
4 SASI_Mm01_00114525 predicted 318
5 SASI_Mm01_00114526 predicted 2004
6 SASI_Mm01_00114527 predicted 2204
7 SASI_Mm01_00114528 predicted 2086
8 SASI_Mm01_00114529 predicted 2282
9 SASI_Mm02_00316020 predicted 1889
10 SASI_Mm01_00114530 predicted 949
11 SASI_Mm01_00114523 predicted 904
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009397
TNFAIP3 MISSION shRNA Bacterial Glycerol Stock
tumor necrosis factor, alpha-induced protein 3
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000378470    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009397.2-331s21c1
Sequence:CCGGATGGGATCATCTATCACTTTACTCGAGTAAAGTGATAGATGATCCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000362922    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009397.2-1366s21c1
Sequence:CCGGAGCTATCACTCATGGATATAACTCGAGTTATATCCATGAGTGATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000362850    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009397.2-1698s21c1
Sequence:CCGGTGCCACGCCCAGCAGATTAATCTCGAGATTAATCTGCTGGGCGTGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030964    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009397.2-2056s1c1
Sequence:CCGGGCACTCTATGTTTCATCGAATCTCGAGATTCGATGAAACATAGAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030965    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009397.2-906s1c1
Sequence:CCGGCCTTTGAAAGTGGGTGGGATTCTCGAGAATCCCACCCACTTTCAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030966    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009397.2-1367s1c1
Sequence:CCGGGCTATCACTCATGGATATAAACTCGAGTTTATATCCATGAGTGATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030968    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009397.2-283s1c1
Sequence:CCGGCTGTGAAGATACGAGAGAGAACTCGAGTTCTCTCTCGTATCTTCACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030967    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009397.2-800s1c1
Sequence:CCGGCCTGGAAGAAATCCACATATTCTCGAGAATATGTGGATTTCTTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009397
TNFAIP3 MISSION shRNA shRNA Plasmid DNA
tumor necrosis factor, alpha-induced protein 3
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000378470    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009397.2-331s21c1
Sequence:CCGGATGGGATCATCTATCACTTTACTCGAGTAAAGTGATAGATGATCCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000362922    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009397.2-1366s21c1
Sequence:CCGGAGCTATCACTCATGGATATAACTCGAGTTATATCCATGAGTGATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000362850    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009397.2-1698s21c1
Sequence:CCGGTGCCACGCCCAGCAGATTAATCTCGAGATTAATCTGCTGGGCGTGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030964    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009397.2-2056s1c1
Sequence:CCGGGCACTCTATGTTTCATCGAATCTCGAGATTCGATGAAACATAGAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030965    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009397.2-906s1c1
Sequence:CCGGCCTTTGAAAGTGGGTGGGATTCTCGAGAATCCCACCCACTTTCAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030966    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009397.2-1367s1c1
Sequence:CCGGGCTATCACTCATGGATATAAACTCGAGTTTATATCCATGAGTGATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030968    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009397.2-283s1c1
Sequence:CCGGCTGTGAAGATACGAGAGAGAACTCGAGTTCTCTCTCGTATCTTCACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030967    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009397.2-800s1c1
Sequence:CCGGCCTGGAAGAAATCCACATATTCTCGAGAATATGTGGATTTCTTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009397
TNFAIP3 MISSION shRNA Lentiviral Transduction Particles
tumor necrosis factor, alpha-induced protein 3
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000378470    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009397.2-331s21c1
Sequence:CCGGATGGGATCATCTATCACTTTACTCGAGTAAAGTGATAGATGATCCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000362922    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009397.2-1366s21c1
Sequence:CCGGAGCTATCACTCATGGATATAACTCGAGTTATATCCATGAGTGATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000362850    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009397.2-1698s21c1
Sequence:CCGGTGCCACGCCCAGCAGATTAATCTCGAGATTAATCTGCTGGGCGTGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030964    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009397.2-2056s1c1
Sequence:CCGGGCACTCTATGTTTCATCGAATCTCGAGATTCGATGAAACATAGAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030965    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009397.2-906s1c1
Sequence:CCGGCCTTTGAAAGTGGGTGGGATTCTCGAGAATCCCACCCACTTTCAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030966    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009397.2-1367s1c1
Sequence:CCGGGCTATCACTCATGGATATAAACTCGAGTTTATATCCATGAGTGATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030968    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009397.2-283s1c1
Sequence:CCGGCTGTGAAGATACGAGAGAGAACTCGAGTTCTCTCTCGTATCTTCACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030967    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009397.2-800s1c1
Sequence:CCGGCCTGGAAGAAATCCACATATTCTCGAGAATATGTGGATTTCTTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006290
VALIDATED
TNFAIP3 MISSION shRNA Bacterial Glycerol Stock
tumor necrosis factor, alpha-induced protein 3
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000218748    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006290.2-957s21c1
Sequence:GTACCGGGATGAAGGAGAAGCTCTTAAACTCGAGTTTAAGAGCTTCTCCTTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218517    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_006290.2-1052s21c1
Sequence:GTACCGGAGTTGGATGAAGCTAACTTACCTCGAGGTAAGTTAGCTTCATCCAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219022    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006290.2-718s21c1
Sequence:GTACCGGTTGGAATCAGGTTCCAATTTCCTCGAGGAAATTGGAACCTGATTCCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229324    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006290.2-3152s21c1
Sequence:CCGGTGTAACTCTTTGGGTTATTACCTCGAGGTAATAACCCAAAGAGTTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229323    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006290.2-1085s21c1
Sequence:CCGGATCTGGTAGATGATTACTTTGCTCGAGCAAAGTAATCATCTACCAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050958    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_006290.2-816s1c1
Sequence:CCGGCGGCTATGACAGCCATCATTTCTCGAGAAATGATGGCTGTCATAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050959    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_006290.2-195s1c1
Sequence:CCGGGCACCGATACACACTGGAAATCTCGAGATTTCCAGTGTGTATCGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050962    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006290.2-2104s1c1
Sequence:CCGGGAAGCTCAGAATCAGAGATTTCTCGAGAAATCTCTGATTCTGAGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050961    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_006290.2-635s1c1
Sequence:CCGGCACTGGAAGAAATACACATATCTCGAGATATGTGTATTTCTTCCAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006290
VALIDATED
TNFAIP3 MISSION shRNA shRNA Plasmid DNA
tumor necrosis factor, alpha-induced protein 3
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000218748    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006290.2-957s21c1
Sequence:GTACCGGGATGAAGGAGAAGCTCTTAAACTCGAGTTTAAGAGCTTCTCCTTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218517    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_006290.2-1052s21c1
Sequence:GTACCGGAGTTGGATGAAGCTAACTTACCTCGAGGTAAGTTAGCTTCATCCAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219022    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006290.2-718s21c1
Sequence:GTACCGGTTGGAATCAGGTTCCAATTTCCTCGAGGAAATTGGAACCTGATTCCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229324    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006290.2-3152s21c1
Sequence:CCGGTGTAACTCTTTGGGTTATTACCTCGAGGTAATAACCCAAAGAGTTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229323    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006290.2-1085s21c1
Sequence:CCGGATCTGGTAGATGATTACTTTGCTCGAGCAAAGTAATCATCTACCAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050958    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_006290.2-816s1c1
Sequence:CCGGCGGCTATGACAGCCATCATTTCTCGAGAAATGATGGCTGTCATAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050959    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_006290.2-195s1c1
Sequence:CCGGGCACCGATACACACTGGAAATCTCGAGATTTCCAGTGTGTATCGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050962    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006290.2-2104s1c1
Sequence:CCGGGAAGCTCAGAATCAGAGATTTCTCGAGAAATCTCTGATTCTGAGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050961    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_006290.2-635s1c1
Sequence:CCGGCACTGGAAGAAATACACATATCTCGAGATATGTGTATTTCTTCCAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006290
VALIDATED
TNFAIP3 MISSION shRNA Lentiviral Transduction Particles
tumor necrosis factor, alpha-induced protein 3
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000218748    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006290.2-957s21c1
Sequence:GTACCGGGATGAAGGAGAAGCTCTTAAACTCGAGTTTAAGAGCTTCTCCTTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218517    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_006290.2-1052s21c1
Sequence:GTACCGGAGTTGGATGAAGCTAACTTACCTCGAGGTAAGTTAGCTTCATCCAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219022    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006290.2-718s21c1
Sequence:GTACCGGTTGGAATCAGGTTCCAATTTCCTCGAGGAAATTGGAACCTGATTCCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229324    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006290.2-3152s21c1
Sequence:CCGGTGTAACTCTTTGGGTTATTACCTCGAGGTAATAACCCAAAGAGTTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229323    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006290.2-1085s21c1
Sequence:CCGGATCTGGTAGATGATTACTTTGCTCGAGCAAAGTAATCATCTACCAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050958    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_006290.2-816s1c1
Sequence:CCGGCGGCTATGACAGCCATCATTTCTCGAGAAATGATGGCTGTCATAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050959    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_006290.2-195s1c1
Sequence:CCGGGCACCGATACACACTGGAAATCTCGAGATTTCCAGTGTGTATCGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050962    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006290.2-2104s1c1
Sequence:CCGGGAAGCTCAGAATCAGAGATTTCTCGAGAAATCTCTGATTCTGAGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050961    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_006290.2-635s1c1
Sequence:CCGGCACTGGAAGAAATACACATATCTCGAGATATGTGTATTTCTTCCAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks