EMAIL THIS PAGE TO A FRIEND

TNFAIP6

tumor necrosis factor, alpha-induced protein 6

Synonyms: TSG-6 TSG6
UniProtKB ID: P98066, Q53TI7, Q8WWI9
Gene ID:
Human(7130) Summary: The protein encoded by this gene is a secretory protein that contains a hyaluronan-binding domain, and thus is a member of the hyaluronan-binding protein family. The hyaluronan-binding domain is known to be involved in extracellular matrix stability and cell migration. This protein has been shown to form a stable complex with inter-alpha-inhibitor (I alpha I), and thus enhance the serine protease inhibitory activity of I alpha I, which is important in the protease network associated with inflammation. This gene can be induced by proinflammatory cytokines such as tumor necrosis factor alpha and interleukin-1. Enhanced levels of this protein are found in the synovial fluid of patients with osteoarthritis and rheumatoid arthritis.[provided by RefSeq, Dec 2010]
Mouse(21930) tumor necrosis factor alpha induced protein 6
Rat(84397) tumor necrosis factor alpha induced protein 6
cow(493710) tumor necrosis factor, alpha-induced protein 6
sheep(101119185) tumor necrosis factor, alpha-induced protein 6
domestic guinea pig(100724247) tumor necrosis factor, alpha-induced protein 6
naked mole-rat(101696504) tumor necrosis factor, alpha-induced protein 6
Domestic Rabbit(100009149) tumor necrosis factor, alpha-induced protein 6
Zebrafish(678516) tumor necrosis factor, alpha-induced protein 6
chicken(424315) tumor necrosis factor, alpha-induced protein 6
dog(476147) tumor necrosis factor, alpha-induced protein 6
domestic cat(101100655) tumor necrosis factor, alpha-induced protein 6
52 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007115 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_007115 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_007115 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009398 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009398 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009398 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_007115 Rosetta Predictions human pricing
NM_053382 Rosetta Predictions rat pricing
NM_009398 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007115 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00232407 predicted 542
2 SASI_Hs01_00232408 predicted 659
3 SASI_Hs01_00232409 predicted 551
4 SASI_Hs01_00232410 predicted 412
5 SASI_Hs01_00232412 predicted 233
6 SASI_Hs01_00232413 predicted 584
7 SASI_Hs01_00232414 predicted 679
8 SASI_Hs02_00342989 predicted 633
9 SASI_Hs02_00342990 predicted 202
10 SASI_Hs01_00232416 predicted 227
11 SASI_Hs01_00232411 predicted 481
12 SASI_Hs01_00232415 predicted 563
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053382 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00265871 predicted 385
2 SASI_Rn02_00265872 predicted 547
3 SASI_Rn02_00265873 predicted 231
4 SASI_Rn02_00265874 predicted 413
5 SASI_Rn02_00265875 predicted 238
6 SASI_Rn02_00265876 predicted 234
7 SASI_Rn02_00265877 predicted 509
8 SASI_Rn02_00265878 predicted 332
9 SASI_Rn02_00265879 predicted 511
10 SASI_Rn02_00265880 predicted 235
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009398 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00316021 predicted 358
2 SASI_Mm02_00316022 predicted 596
3 SASI_Mm02_00316023 predicted 380
4 SASI_Mm02_00316024 predicted 559
5 SASI_Mm02_00316025 predicted 425
6 SASI_Mm02_00316026 predicted 631
7 SASI_Mm02_00316027 predicted 535
8 SASI_Mm02_00316028 predicted 627
9 SASI_Mm02_00316029 predicted 308
10 SASI_Mm02_00316030 predicted 503
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007115
TNFAIP6 MISSION shRNA Bacterial Glycerol Stock
tumor necrosis factor, alpha-induced protein 6
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000115987    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007115.2-1099s1c1
Sequence:CCGGGCATAGAAATAACAAGCGTTACTCGAGTAACGCTTGTTATTTCTATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115988    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007115.2-785s1c1
Sequence:CCGGGCTGGAGGTTTCCAAATCAAACTCGAGTTTGATTTGGAAACCTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115991    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007115.2-640s1c1
Sequence:CCGGCTTGGCTGATTATGTTGAAATCTCGAGATTTCAACATAATCAGCCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115990    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007115.2-483s1c1
Sequence:CCGGGTGGCGTCTTTACAGATCCAACTCGAGTTGGATCTGTAAAGACGCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115989    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007115.2-529s1c1
Sequence:CCGGCCCAAATGAGTACGAAGATAACTCGAGTTATCTTCGTACTCATTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434588    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007115.2-890s21c1
Sequence:CCGGGGAAGATTTAGCCACTTATAACTCGAGTTATAAGTGGCTAAATCTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426270    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007115.2-411s21c1
Sequence:CCGGATTATGGAATCCGTCTCAATACTCGAGTATTGAGACGGATTCCATAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428928    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007115.2-436s21c1
Sequence:CCGGTGAAAGATGGGATGCCTATTGCTCGAGCAATAGGCATCCCATCTTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007115
TNFAIP6 MISSION shRNA shRNA Plasmid DNA
tumor necrosis factor, alpha-induced protein 6
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000115987    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007115.2-1099s1c1
Sequence:CCGGGCATAGAAATAACAAGCGTTACTCGAGTAACGCTTGTTATTTCTATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115988    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007115.2-785s1c1
Sequence:CCGGGCTGGAGGTTTCCAAATCAAACTCGAGTTTGATTTGGAAACCTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115991    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007115.2-640s1c1
Sequence:CCGGCTTGGCTGATTATGTTGAAATCTCGAGATTTCAACATAATCAGCCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115990    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007115.2-483s1c1
Sequence:CCGGGTGGCGTCTTTACAGATCCAACTCGAGTTGGATCTGTAAAGACGCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115989    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007115.2-529s1c1
Sequence:CCGGCCCAAATGAGTACGAAGATAACTCGAGTTATCTTCGTACTCATTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434588    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007115.2-890s21c1
Sequence:CCGGGGAAGATTTAGCCACTTATAACTCGAGTTATAAGTGGCTAAATCTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426270    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007115.2-411s21c1
Sequence:CCGGATTATGGAATCCGTCTCAATACTCGAGTATTGAGACGGATTCCATAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428928    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007115.2-436s21c1
Sequence:CCGGTGAAAGATGGGATGCCTATTGCTCGAGCAATAGGCATCCCATCTTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007115
TNFAIP6 MISSION shRNA Lentiviral Transduction Particles
tumor necrosis factor, alpha-induced protein 6
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000115987    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007115.2-1099s1c1
Sequence:CCGGGCATAGAAATAACAAGCGTTACTCGAGTAACGCTTGTTATTTCTATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115988    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007115.2-785s1c1
Sequence:CCGGGCTGGAGGTTTCCAAATCAAACTCGAGTTTGATTTGGAAACCTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115991    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007115.2-640s1c1
Sequence:CCGGCTTGGCTGATTATGTTGAAATCTCGAGATTTCAACATAATCAGCCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115990    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007115.2-483s1c1
Sequence:CCGGGTGGCGTCTTTACAGATCCAACTCGAGTTGGATCTGTAAAGACGCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115989    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007115.2-529s1c1
Sequence:CCGGCCCAAATGAGTACGAAGATAACTCGAGTTATCTTCGTACTCATTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434588    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007115.2-890s21c1
Sequence:CCGGGGAAGATTTAGCCACTTATAACTCGAGTTATAAGTGGCTAAATCTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426270    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007115.2-411s21c1
Sequence:CCGGATTATGGAATCCGTCTCAATACTCGAGTATTGAGACGGATTCCATAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428928    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007115.2-436s21c1
Sequence:CCGGTGAAAGATGGGATGCCTATTGCTCGAGCAATAGGCATCCCATCTTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009398
TNFAIP6 MISSION shRNA Bacterial Glycerol Stock
tumor necrosis factor, alpha-induced protein 6
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000109494    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009398.1-870s1c1
Sequence:CCGGTGGAAGGTTTAGCCATCTATACTCGAGTATAGATGGCTAAACCTTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109493    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009398.1-868s1c1
Sequence:CCGGCCTGGAAGGTTTAGCCATCTACTCGAGTAGATGGCTAAACCTTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109492    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009398.1-631s1c1
Sequence:CCGGGCTGACTATGTAGAAATCTATCTCGAGATAGATTTCTACATAGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109491    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009398.1-516s1c1
Sequence:CCGGCCCAAATGAGTACGATGACAACTCGAGTTGTCATCGTACTCATTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109490    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009398.1-1122s1c1
Sequence:CCGGCCCGGCTTCAATATTTATATTCTCGAGAATATAAATATTGAAGCCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009398
TNFAIP6 MISSION shRNA shRNA Plasmid DNA
tumor necrosis factor, alpha-induced protein 6
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000109494    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009398.1-870s1c1
Sequence:CCGGTGGAAGGTTTAGCCATCTATACTCGAGTATAGATGGCTAAACCTTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109493    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009398.1-868s1c1
Sequence:CCGGCCTGGAAGGTTTAGCCATCTACTCGAGTAGATGGCTAAACCTTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109492    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009398.1-631s1c1
Sequence:CCGGGCTGACTATGTAGAAATCTATCTCGAGATAGATTTCTACATAGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109491    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009398.1-516s1c1
Sequence:CCGGCCCAAATGAGTACGATGACAACTCGAGTTGTCATCGTACTCATTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109490    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009398.1-1122s1c1
Sequence:CCGGCCCGGCTTCAATATTTATATTCTCGAGAATATAAATATTGAAGCCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009398
TNFAIP6 MISSION shRNA Lentiviral Transduction Particles
tumor necrosis factor, alpha-induced protein 6
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000109494    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009398.1-870s1c1
Sequence:CCGGTGGAAGGTTTAGCCATCTATACTCGAGTATAGATGGCTAAACCTTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109493    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009398.1-868s1c1
Sequence:CCGGCCTGGAAGGTTTAGCCATCTACTCGAGTAGATGGCTAAACCTTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109492    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009398.1-631s1c1
Sequence:CCGGGCTGACTATGTAGAAATCTATCTCGAGATAGATTTCTACATAGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109491    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009398.1-516s1c1
Sequence:CCGGCCCAAATGAGTACGATGACAACTCGAGTTGTCATCGTACTCATTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109490    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009398.1-1122s1c1
Sequence:CCGGCCCGGCTTCAATATTTATATTCTCGAGAATATAAATATTGAAGCCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks