EMAIL THIS PAGE TO A FRIEND

TNFAIP8

tumor necrosis factor, alpha-induced protein 8

Synonyms: GG2-1 MDC-3.13 SCC-S2 SCCS2
UniProtKB ID: O95379, B3KMH1, B3KMI2, Q9P1Q1, Q9UER5, Q9UP47
Gene ID:
Mouse(106869) tumor necrosis factor, alpha-induced protein 8
Rat(307428) tumor necrosis factor, alpha-induced protein 8
Zebrafish(393303) tumor necrosis factor, alpha-induced protein 8
domestic cat(101091590) tumor necrosis factor, alpha-induced protein 8
dog(481428) tumor necrosis factor, alpha-induced protein 8
chicken(427384) tumor necrosis factor, alpha-induced protein 8
naked mole-rat(101714316) tumor necrosis factor, alpha-induced protein 8
domestic guinea pig(100716932) tumor necrosis factor, alpha-induced protein 8
cow(529336) tumor necrosis factor, alpha-induced protein 8
sheep(101114952) tumor necrosis factor, alpha-induced protein 8
143 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_134131 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_134131 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_134131 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_014350 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014350 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014350 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU054891 MISSION® esiRNA esiRNA human TNFAIP8 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001077654 Rosetta Predictions human pricing
NM_014350 Rosetta Predictions human pricing
NM_001107387 Rosetta Predictions rat pricing
NM_134131 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001077654 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00313067 predicted 867
2 SASI_Hs02_00313068 predicted 543
3 SASI_Hs02_00313069 predicted 493
4 SASI_Hs02_00313070 predicted 597
5 SASI_Hs02_00313071 predicted 598
6 SASI_Hs02_00313072 predicted 409
7 SASI_Hs02_00313073 predicted 701
8 SASI_Hs02_00313074 predicted 509
9 SASI_Hs02_00313075 predicted 473
10 SASI_Hs02_00313076 predicted 952
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014350 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00345496 predicted 898
2 SASI_Hs01_00139224 predicted 572
3 SASI_Hs02_00345497 predicted 524
4 SASI_Hs01_00139226 predicted 638
5 SASI_Hs01_00139227 predicted 636
6 SASI_Hs01_00139229 predicted 447
7 SASI_Hs01_00139230 predicted 733
8 SASI_Hs01_00139231 predicted 541
9 SASI_Hs02_00345498 predicted 515
10 SASI_Hs02_00345499 predicted 982
11 SASI_Hs01_00139225 predicted 865
12 SASI_Hs01_00139228 predicted 291
13 SASI_Hs01_00139232 predicted 394
14 SASI_Hs01_00139233 predicted 850
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107387 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00228315 predicted 1309
2 SASI_Rn02_00228316 predicted 804
3 SASI_Rn02_00228317 predicted 915
4 SASI_Rn02_00228318 predicted 1408
5 SASI_Rn02_00228319 predicted 964
6 SASI_Rn02_00228320 predicted 1042
7 SASI_Rn02_00228321 predicted 1168
8 SASI_Rn02_00228322 predicted 825
9 SASI_Rn02_00228323 predicted 1396
10 SASI_Rn02_00228324 predicted 713
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_134131 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00070171 predicted 478
2 SASI_Mm01_00070163 predicted 403
3 SASI_Mm01_00070164 predicted 428
4 SASI_Mm01_00070165 predicted 613
5 SASI_Mm01_00070167 predicted 573
6 SASI_Mm02_00339377 predicted 239
7 SASI_Mm01_00070168 predicted 289
8 SASI_Mm01_00070169 predicted 521
9 SASI_Mm01_00070170 predicted 422
10 SASI_Mm01_00070166 predicted 615
11 SASI_Mm01_00070172 predicted 326
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_134131
VALIDATED
TNFAIP8 MISSION shRNA Bacterial Glycerol Stock
tumor necrosis factor, alpha-induced protein 8
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000375642    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134131.1-479s21c1
Sequence:CCGGAGCTCCTACACGAGATCATTCCTCGAGGAATGATCTCGTGTAGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000367650    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_134131.1-321s21c1
Sequence:CCGGCCTCCACAGGAACAATCAGTTCTCGAGAACTGATTGTTCCTGTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000348693    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_134131.1-518s21c1
Sequence:CCGGAGTCTCACGGACGGGTTAATACTCGAGTATTAACCCGTCCGTGAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000351748    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_134131.1-792s21c1
Sequence:CCGGCCTGTTATTGTTGTTGGACATCTCGAGATGTCCAACAACAATAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000351747    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134131.1-574s21c1
Sequence:CCGGGCTGCCTTGTACAATCCCTTTCTCGAGAAAGGGATTGTACAAGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000375643    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_134131.1-101s21c1
Sequence:CCGGTGGCTACAGATGTCTTCAATTCTCGAGAATTGAAGACATCTGTAGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100260    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134131.1-792s1c1
Sequence:CCGGCCTGTTATTGTTGTTGGACATCTCGAGATGTCCAACAACAATAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100264    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134131.1-324s1c1
Sequence:CCGGCCACAGGAACAATCAGTTCAACTCGAGTTGAACTGATTGTTCCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100261    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134131.1-525s1c1
Sequence:CCGGCGGACGGGTTAATAATGTCTTCTCGAGAAGACATTATTAACCCGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100262    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134131.1-574s1c1
Sequence:CCGGGCTGCCTTGTACAATCCCTTTCTCGAGAAAGGGATTGTACAAGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100263    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134131.1-321s1c1
Sequence:CCGGCCTCCACAGGAACAATCAGTTCTCGAGAACTGATTGTTCCTGTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_134131
VALIDATED
TNFAIP8 MISSION shRNA shRNA Plasmid DNA
tumor necrosis factor, alpha-induced protein 8
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000375642    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134131.1-479s21c1
Sequence:CCGGAGCTCCTACACGAGATCATTCCTCGAGGAATGATCTCGTGTAGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000367650    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_134131.1-321s21c1
Sequence:CCGGCCTCCACAGGAACAATCAGTTCTCGAGAACTGATTGTTCCTGTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000348693    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_134131.1-518s21c1
Sequence:CCGGAGTCTCACGGACGGGTTAATACTCGAGTATTAACCCGTCCGTGAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000351748    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_134131.1-792s21c1
Sequence:CCGGCCTGTTATTGTTGTTGGACATCTCGAGATGTCCAACAACAATAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000351747    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134131.1-574s21c1
Sequence:CCGGGCTGCCTTGTACAATCCCTTTCTCGAGAAAGGGATTGTACAAGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000375643    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_134131.1-101s21c1
Sequence:CCGGTGGCTACAGATGTCTTCAATTCTCGAGAATTGAAGACATCTGTAGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100260    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134131.1-792s1c1
Sequence:CCGGCCTGTTATTGTTGTTGGACATCTCGAGATGTCCAACAACAATAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100264    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134131.1-324s1c1
Sequence:CCGGCCACAGGAACAATCAGTTCAACTCGAGTTGAACTGATTGTTCCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100261    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134131.1-525s1c1
Sequence:CCGGCGGACGGGTTAATAATGTCTTCTCGAGAAGACATTATTAACCCGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100262    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134131.1-574s1c1
Sequence:CCGGGCTGCCTTGTACAATCCCTTTCTCGAGAAAGGGATTGTACAAGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100263    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134131.1-321s1c1
Sequence:CCGGCCTCCACAGGAACAATCAGTTCTCGAGAACTGATTGTTCCTGTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_134131
VALIDATED
TNFAIP8 MISSION shRNA Lentiviral Transduction Particles
tumor necrosis factor, alpha-induced protein 8
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000375642    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134131.1-479s21c1
Sequence:CCGGAGCTCCTACACGAGATCATTCCTCGAGGAATGATCTCGTGTAGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000367650    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_134131.1-321s21c1
Sequence:CCGGCCTCCACAGGAACAATCAGTTCTCGAGAACTGATTGTTCCTGTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000348693    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_134131.1-518s21c1
Sequence:CCGGAGTCTCACGGACGGGTTAATACTCGAGTATTAACCCGTCCGTGAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000351748    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_134131.1-792s21c1
Sequence:CCGGCCTGTTATTGTTGTTGGACATCTCGAGATGTCCAACAACAATAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000351747    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134131.1-574s21c1
Sequence:CCGGGCTGCCTTGTACAATCCCTTTCTCGAGAAAGGGATTGTACAAGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000375643    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_134131.1-101s21c1
Sequence:CCGGTGGCTACAGATGTCTTCAATTCTCGAGAATTGAAGACATCTGTAGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100260    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134131.1-792s1c1
Sequence:CCGGCCTGTTATTGTTGTTGGACATCTCGAGATGTCCAACAACAATAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100264    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134131.1-324s1c1
Sequence:CCGGCCACAGGAACAATCAGTTCAACTCGAGTTGAACTGATTGTTCCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100261    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134131.1-525s1c1
Sequence:CCGGCGGACGGGTTAATAATGTCTTCTCGAGAAGACATTATTAACCCGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100262    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134131.1-574s1c1
Sequence:CCGGGCTGCCTTGTACAATCCCTTTCTCGAGAAAGGGATTGTACAAGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100263    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134131.1-321s1c1
Sequence:CCGGCCTCCACAGGAACAATCAGTTCTCGAGAACTGATTGTTCCTGTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014350
VALIDATED
TNFAIP8 MISSION shRNA Bacterial Glycerol Stock
tumor necrosis factor, alpha-induced protein 8
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000271629    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014350.2-639s21c1
Sequence:CCGGAGTCACATGGACGGGTTAATACTCGAGTATTAACCCGTCCATGTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000271582    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014350.2-1387s21c1
Sequence:CCGGATGAATAATGTCCAGTATAAGCTCGAGCTTATACTGGACATTATTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000271630    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014350.2-600s21c1
Sequence:CCGGAGATGCTGCACCAAATCATTCCTCGAGGAATGATTTGGTGCAGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000271627    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014350.2-427s21c1
Sequence:CCGGCATCAAGCTGGCCATTCTTTACTCGAGTAAAGAATGGCCAGCTTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116161    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014350.1-441s1c1
Sequence:CCGGCAGTTTAATCAAGATGAGCTACTCGAGTAGCTCATCTTGATTAAACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116158    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014350.1-292s1c1
Sequence:CCGGCCACCTTAATAGACGACACAACTCGAGTTGTGTCGTCTATTAAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116157    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014350.1-1185s1c1
Sequence:CCGGCCAAGAACTTTCTCTTGCTATCTCGAGATAGCAAGAGAAAGTTCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116160    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014350.1-517s1c1
Sequence:CCGGGTTTCCATCAGGTGGATTATACTCGAGTATAATCCACCTGATGGAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116159    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_014350.1-748s1c1
Sequence:CCGGTGTTGGATGAAGAGAACATATCTCGAGATATGTTCTCTTCATCCAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014350
VALIDATED
TNFAIP8 MISSION shRNA shRNA Plasmid DNA
tumor necrosis factor, alpha-induced protein 8
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000271629    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014350.2-639s21c1
Sequence:CCGGAGTCACATGGACGGGTTAATACTCGAGTATTAACCCGTCCATGTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000271582    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014350.2-1387s21c1
Sequence:CCGGATGAATAATGTCCAGTATAAGCTCGAGCTTATACTGGACATTATTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000271630    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014350.2-600s21c1
Sequence:CCGGAGATGCTGCACCAAATCATTCCTCGAGGAATGATTTGGTGCAGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000271627    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014350.2-427s21c1
Sequence:CCGGCATCAAGCTGGCCATTCTTTACTCGAGTAAAGAATGGCCAGCTTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116161    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014350.1-441s1c1
Sequence:CCGGCAGTTTAATCAAGATGAGCTACTCGAGTAGCTCATCTTGATTAAACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116158    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014350.1-292s1c1
Sequence:CCGGCCACCTTAATAGACGACACAACTCGAGTTGTGTCGTCTATTAAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116157    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014350.1-1185s1c1
Sequence:CCGGCCAAGAACTTTCTCTTGCTATCTCGAGATAGCAAGAGAAAGTTCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116160    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014350.1-517s1c1
Sequence:CCGGGTTTCCATCAGGTGGATTATACTCGAGTATAATCCACCTGATGGAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116159    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_014350.1-748s1c1
Sequence:CCGGTGTTGGATGAAGAGAACATATCTCGAGATATGTTCTCTTCATCCAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014350
VALIDATED
TNFAIP8 MISSION shRNA Lentiviral Transduction Particles
tumor necrosis factor, alpha-induced protein 8
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000271629    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014350.2-639s21c1
Sequence:CCGGAGTCACATGGACGGGTTAATACTCGAGTATTAACCCGTCCATGTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000271582    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014350.2-1387s21c1
Sequence:CCGGATGAATAATGTCCAGTATAAGCTCGAGCTTATACTGGACATTATTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000271630    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014350.2-600s21c1
Sequence:CCGGAGATGCTGCACCAAATCATTCCTCGAGGAATGATTTGGTGCAGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000271627    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014350.2-427s21c1
Sequence:CCGGCATCAAGCTGGCCATTCTTTACTCGAGTAAAGAATGGCCAGCTTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116161    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014350.1-441s1c1
Sequence:CCGGCAGTTTAATCAAGATGAGCTACTCGAGTAGCTCATCTTGATTAAACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116158    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014350.1-292s1c1
Sequence:CCGGCCACCTTAATAGACGACACAACTCGAGTTGTGTCGTCTATTAAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116157    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014350.1-1185s1c1
Sequence:CCGGCCAAGAACTTTCTCTTGCTATCTCGAGATAGCAAGAGAAAGTTCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116160    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014350.1-517s1c1
Sequence:CCGGGTTTCCATCAGGTGGATTATACTCGAGTATAATCCACCTGATGGAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116159    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_014350.1-748s1c1
Sequence:CCGGTGTTGGATGAAGAGAACATATCTCGAGATATGTTCTCTTCATCCAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks