EMAIL THIS PAGE TO A FRIEND

TNFAIP8L1

tumor necrosis factor, alpha-induced protein 8-like 1

Synonyms: TIPE1
UniProtKB ID: Q8WVP5, D6W627
Gene ID:
Mouse(66443) tumor necrosis factor, alpha-induced protein 8-like 1
Rat(301131) tumor necrosis factor, alpha-induced protein 8-like 1
cow(531850) tumor necrosis factor, alpha-induced protein 8-like 1
sheep(101111278) tumor necrosis factor, alpha-induced protein 8-like 1
naked mole-rat(101724764) tumor necrosis factor, alpha-induced protein 8-like 1
chicken(420162) tumor necrosis factor, alpha-induced protein 8-like 1
dog(485034) tumor necrosis factor, alpha-induced protein 8-like 1
domestic cat(101090843) tumor necrosis factor, alpha-induced protein 8-like 1
52 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2102488 Anti-TNFAIP8L1 antibody produced in rabbit affinity isolated antibody horse, bovine, mouse, human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152362 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152362 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152362 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_025566 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025566 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025566 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152362 Rosetta Predictions human pricing
XM_001061429 Rosetta Predictions rat pricing
XM_236787 Rosetta Predictions rat pricing
NM_025566 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152362 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00128837 predicted 836
2 SASI_Hs01_00128838 predicted 848
3 SASI_Hs01_00128839 predicted 845
4 SASI_Hs01_00128840 predicted 300
5 SASI_Hs01_00128841 predicted 420
6 SASI_Hs01_00128842 predicted 407
7 SASI_Hs01_00128843 predicted 832
8 SASI_Hs01_00128844 predicted 767
9 SASI_Hs01_00128845 predicted 248
10 SASI_Hs02_00366006 predicted 398
11 SASI_Hs01_00128836 predicted 568
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001061429 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00300074 predicted 314
2 SASI_Rn02_00300075 predicted 422
3 SASI_Rn02_00300076 predicted 221
4 SASI_Rn02_00300077 predicted 441
5 SASI_Rn02_00300078 predicted 428
6 SASI_Rn02_00300079 predicted 217
7 SASI_Rn02_00300080 predicted 230
8 SASI_Rn02_00300081 predicted 292
9 SASI_Rn02_00300082 predicted 317
10 SASI_Rn02_00300083 predicted 257
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_236787 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00390430 predicted 315
2 SASI_Rn02_00390431 predicted 313
3 SASI_Rn02_00390432 predicted 400
4 SASI_Rn02_00390433 predicted 322
5 SASI_Rn02_00390434 predicted 400
6 SASI_Rn02_00390435 predicted 326
7 SASI_Rn02_00390436 predicted 362
8 SASI_Rn02_00390437 predicted 355
9 SASI_Rn02_00390438 predicted 389
10 SASI_Rn02_00390439 predicted 391
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025566 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00173067 predicted 1059
2 SASI_Mm01_00173068 predicted 925
3 SASI_Mm01_00173069 predicted 430
4 SASI_Mm02_00328541 predicted 1051
5 SASI_Mm01_00173070 predicted 928
6 SASI_Mm01_00173071 predicted 983
7 SASI_Mm01_00173072 predicted 901
8 SASI_Mm01_00173073 predicted 934
9 SASI_Mm01_00173074 predicted 1071
10 SASI_Mm01_00173075 predicted 1051
11 SASI_Mm01_00173066 predicted 916
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152362
VALIDATED
TNFAIP8L1 MISSION shRNA Bacterial Glycerol Stock
tumor necrosis factor, alpha-induced protein 8-like 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000165873    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_152362.1-1588s1c1
Sequence:CCGGGCAGTGGCTCACTACTGTAATCTCGAGATTACAGTAGTGAGCCACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165116    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_152362.1-283s1c1
Sequence:CCGGCCAGAAGATGCTCAAGAACCTCTCGAGAGGTTCTTGAGCATCTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161370    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_152362.1-1638s1c1
Sequence:CCGGGATTGCTTGAACTCAGAAGTTCTCGAGAACTTCTGAGTTCAAGCAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159560    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_152362.1-1186s1c1
Sequence:CCGGGATGGAATTAGTTCAGATGATCTCGAGATCATCTGAACTAATTCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159230    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_152362.1-1161s1c1
Sequence:CCGGCTGATTTGGAAATAGGATCATCTCGAGATGATCCTATTTCCAAATCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159759    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152362.1-1152s1c1
Sequence:CCGGGAAGATGATCTGATTTGGAAACTCGAGTTTCCAAATCAGATCATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163157    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_152362.1-847s1c1
Sequence:CCGGGCAGCTGTTTCAAACACCAATCTCGAGATTGGTGTTTGAAACAGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165350    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152362.1-289s1c1
Sequence:CCGGGATGCTCAAGAACCTGGTCAACTCGAGTTGACCAGGTTCTTGAGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165459    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152362.1-154s1c1
Sequence:CCGGGCAGAAGAAGCTCCTGAGTAACTCGAGTTACTCAGGAGCTTCTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165586    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152362.1-2058s1c1
Sequence:CCGGGCACACGTATAATCCCAGCTACTCGAGTAGCTGGGATTATACGTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152362
VALIDATED
TNFAIP8L1 MISSION shRNA shRNA Plasmid DNA
tumor necrosis factor, alpha-induced protein 8-like 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000165873    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_152362.1-1588s1c1
Sequence:CCGGGCAGTGGCTCACTACTGTAATCTCGAGATTACAGTAGTGAGCCACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165116    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_152362.1-283s1c1
Sequence:CCGGCCAGAAGATGCTCAAGAACCTCTCGAGAGGTTCTTGAGCATCTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161370    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_152362.1-1638s1c1
Sequence:CCGGGATTGCTTGAACTCAGAAGTTCTCGAGAACTTCTGAGTTCAAGCAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159560    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_152362.1-1186s1c1
Sequence:CCGGGATGGAATTAGTTCAGATGATCTCGAGATCATCTGAACTAATTCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159230    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_152362.1-1161s1c1
Sequence:CCGGCTGATTTGGAAATAGGATCATCTCGAGATGATCCTATTTCCAAATCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159759    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152362.1-1152s1c1
Sequence:CCGGGAAGATGATCTGATTTGGAAACTCGAGTTTCCAAATCAGATCATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163157    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_152362.1-847s1c1
Sequence:CCGGGCAGCTGTTTCAAACACCAATCTCGAGATTGGTGTTTGAAACAGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165350    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152362.1-289s1c1
Sequence:CCGGGATGCTCAAGAACCTGGTCAACTCGAGTTGACCAGGTTCTTGAGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165459    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152362.1-154s1c1
Sequence:CCGGGCAGAAGAAGCTCCTGAGTAACTCGAGTTACTCAGGAGCTTCTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165586    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152362.1-2058s1c1
Sequence:CCGGGCACACGTATAATCCCAGCTACTCGAGTAGCTGGGATTATACGTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152362
VALIDATED
TNFAIP8L1 MISSION shRNA Lentiviral Transduction Particles
tumor necrosis factor, alpha-induced protein 8-like 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000165873    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_152362.1-1588s1c1
Sequence:CCGGGCAGTGGCTCACTACTGTAATCTCGAGATTACAGTAGTGAGCCACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165116    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_152362.1-283s1c1
Sequence:CCGGCCAGAAGATGCTCAAGAACCTCTCGAGAGGTTCTTGAGCATCTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161370    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_152362.1-1638s1c1
Sequence:CCGGGATTGCTTGAACTCAGAAGTTCTCGAGAACTTCTGAGTTCAAGCAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159560    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_152362.1-1186s1c1
Sequence:CCGGGATGGAATTAGTTCAGATGATCTCGAGATCATCTGAACTAATTCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159230    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_152362.1-1161s1c1
Sequence:CCGGCTGATTTGGAAATAGGATCATCTCGAGATGATCCTATTTCCAAATCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159759    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152362.1-1152s1c1
Sequence:CCGGGAAGATGATCTGATTTGGAAACTCGAGTTTCCAAATCAGATCATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163157    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_152362.1-847s1c1
Sequence:CCGGGCAGCTGTTTCAAACACCAATCTCGAGATTGGTGTTTGAAACAGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165350    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152362.1-289s1c1
Sequence:CCGGGATGCTCAAGAACCTGGTCAACTCGAGTTGACCAGGTTCTTGAGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165459    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152362.1-154s1c1
Sequence:CCGGGCAGAAGAAGCTCCTGAGTAACTCGAGTTACTCAGGAGCTTCTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165586    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152362.1-2058s1c1
Sequence:CCGGGCACACGTATAATCCCAGCTACTCGAGTAGCTGGGATTATACGTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025566
TNFAIP8L1 MISSION shRNA Bacterial Glycerol Stock
tumor necrosis factor, alpha-induced protein 8-like 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000121447    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025566.2-695s1c1
Sequence:CCGGCCTCTGTTTCTCCTGCTGTAACTCGAGTTACAGCAGGAGAAACAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121449    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025566.2-472s1c1
Sequence:CCGGGCCGCATCAATCACATCTTCACTCGAGTGAAGATGTGATTGATGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121450    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025566.2-153s1c1
Sequence:CCGGAGCAGTGAGGTCTTGGATGAACTCGAGTTCATCCAAGACCTCACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121448    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025566.2-363s1c1
Sequence:CCGGCACCAGGTAGACTTCACCTTTCTCGAGAAAGGTGAAGTCTACCTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121451    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025566.2-537s1c1
Sequence:CCGGGCAGAGCCCTACCGGAGCCATCTCGAGATGGCTCCGGTAGGGCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025566
TNFAIP8L1 MISSION shRNA shRNA Plasmid DNA
tumor necrosis factor, alpha-induced protein 8-like 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000121447    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025566.2-695s1c1
Sequence:CCGGCCTCTGTTTCTCCTGCTGTAACTCGAGTTACAGCAGGAGAAACAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121449    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025566.2-472s1c1
Sequence:CCGGGCCGCATCAATCACATCTTCACTCGAGTGAAGATGTGATTGATGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121450    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025566.2-153s1c1
Sequence:CCGGAGCAGTGAGGTCTTGGATGAACTCGAGTTCATCCAAGACCTCACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121448    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025566.2-363s1c1
Sequence:CCGGCACCAGGTAGACTTCACCTTTCTCGAGAAAGGTGAAGTCTACCTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121451    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025566.2-537s1c1
Sequence:CCGGGCAGAGCCCTACCGGAGCCATCTCGAGATGGCTCCGGTAGGGCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025566
TNFAIP8L1 MISSION shRNA Lentiviral Transduction Particles
tumor necrosis factor, alpha-induced protein 8-like 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000121447    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025566.2-695s1c1
Sequence:CCGGCCTCTGTTTCTCCTGCTGTAACTCGAGTTACAGCAGGAGAAACAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121449    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025566.2-472s1c1
Sequence:CCGGGCCGCATCAATCACATCTTCACTCGAGTGAAGATGTGATTGATGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121450    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025566.2-153s1c1
Sequence:CCGGAGCAGTGAGGTCTTGGATGAACTCGAGTTCATCCAAGACCTCACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121448    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025566.2-363s1c1
Sequence:CCGGCACCAGGTAGACTTCACCTTTCTCGAGAAAGGTGAAGTCTACCTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121451    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025566.2-537s1c1
Sequence:CCGGGCAGAGCCCTACCGGAGCCATCTCGAGATGGCTCCGGTAGGGCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks