EMAIL THIS PAGE TO A FRIEND

TNFAIP8L2

tumor necrosis factor, alpha-induced protein 8-like 2

Synonyms: TIPE2
UniProtKB ID: Q6P589, Q6I9Y0, Q9H2H7, Q9H5G2
Gene ID:
Mouse(69769) tumor necrosis factor, alpha-induced protein 8-like 2
Rat(310663) tumor necrosis factor, alpha-induced protein 8-like 2
dog(483192) tumor necrosis factor, alpha-induced protein 8-like 2
domestic cat(101096752) tumor necrosis factor, alpha-induced protein 8-like 2
naked mole-rat(101704834) tumor necrosis factor, alpha-induced protein 8-like 2
Domestic Rabbit(100328663) tumor necrosis factor, alpha-induced protein 8-like 2
domestic guinea pig(100732897) tumor necrosis factor, alpha-induced protein 8-like 2
cow(510652) tumor necrosis factor, alpha-induced protein 8-like 2
sheep(101112178) tumor necrosis factor, alpha-induced protein 8-like 2
84 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_027206 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027206 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027206 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_024575 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024575 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024575 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024575 Rosetta Predictions human pricing
NM_001014039 Rosetta Predictions rat pricing
NM_027206 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024575 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00356895 predicted 410
2 SASI_Hs01_00144408 predicted 224
3 SASI_Hs01_00144409 predicted 945
4 SASI_Hs01_00144410 predicted 592
5 SASI_Hs01_00144411 predicted 944
6 SASI_Hs01_00144413 predicted 687
7 SASI_Hs02_00356896 predicted 298
8 SASI_Hs01_00144414 predicted 293
9 SASI_Hs02_00356897 predicted 433
10 SASI_Hs01_00144416 predicted 560
11 SASI_Hs01_00144407 predicted 390
12 SASI_Hs01_00144412 predicted 934
13 SASI_Hs01_00144415 predicted 405
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001014039 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00060361 predicted 974
2 SASI_Rn01_00060362 predicted 780
3 SASI_Rn01_00060363 predicted 648
4 SASI_Rn01_00060364 predicted 1142
5 SASI_Rn01_00060365 predicted 371
6 SASI_Rn01_00060366 predicted 553
7 SASI_Rn01_00060368 predicted 715
8 SASI_Rn01_00060369 predicted 1061
9 SASI_Rn02_00201427 predicted 827
10 SASI_Rn02_00201428 predicted 515
11 SASI_Rn01_00060360 predicted 952
12 SASI_Rn01_00060367 predicted 1056
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027206 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00162517 predicted 286
2 SASI_Mm01_00162519 predicted 556
3 SASI_Mm01_00162520 predicted 888
4 SASI_Mm01_00162521 predicted 504
5 SASI_Mm01_00162522 predicted 375
6 SASI_Mm01_00162523 predicted 585
7 SASI_Mm01_00162525 predicted 277
8 SASI_Mm01_00162526 predicted 859
9 SASI_Mm02_00331749 predicted 259
10 SASI_Mm02_00331750 predicted 862
11 SASI_Mm01_00162518 predicted 707
12 SASI_Mm01_00162524 predicted 712
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027206
TNFAIP8L2 MISSION shRNA Bacterial Glycerol Stock
tumor necrosis factor, alpha-induced protein 8-like 2
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000121347    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027206.1-875s1c1
Sequence:CCGGGCTGACTGAAGAAGAAGTGAACTCGAGTTCACTTCTTCTTCAGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121350    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027206.1-278s1c1
Sequence:CCGGACCTCATCAAGGTAGCGGTTACTCGAGTAACCGCTACCTTGATGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121351    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027206.1-225s1c1
Sequence:CCGGCGTGTCCAAAGAATACACGCACTCGAGTGCGTGTATTCTTTGGACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121348    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027206.1-279s1c1
Sequence:CCGGCCTCATCAAGGTAGCGGTTAACTCGAGTTAACCGCTACCTTGATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027206
TNFAIP8L2 MISSION shRNA shRNA Plasmid DNA
tumor necrosis factor, alpha-induced protein 8-like 2
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000121347    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027206.1-875s1c1
Sequence:CCGGGCTGACTGAAGAAGAAGTGAACTCGAGTTCACTTCTTCTTCAGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121350    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027206.1-278s1c1
Sequence:CCGGACCTCATCAAGGTAGCGGTTACTCGAGTAACCGCTACCTTGATGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121351    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027206.1-225s1c1
Sequence:CCGGCGTGTCCAAAGAATACACGCACTCGAGTGCGTGTATTCTTTGGACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121348    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027206.1-279s1c1
Sequence:CCGGCCTCATCAAGGTAGCGGTTAACTCGAGTTAACCGCTACCTTGATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027206
TNFAIP8L2 MISSION shRNA Lentiviral Transduction Particles
tumor necrosis factor, alpha-induced protein 8-like 2
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000121347    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027206.1-875s1c1
Sequence:CCGGGCTGACTGAAGAAGAAGTGAACTCGAGTTCACTTCTTCTTCAGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121350    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027206.1-278s1c1
Sequence:CCGGACCTCATCAAGGTAGCGGTTACTCGAGTAACCGCTACCTTGATGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121351    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027206.1-225s1c1
Sequence:CCGGCGTGTCCAAAGAATACACGCACTCGAGTGCGTGTATTCTTTGGACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121348    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027206.1-279s1c1
Sequence:CCGGCCTCATCAAGGTAGCGGTTAACTCGAGTTAACCGCTACCTTGATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024575
TNFAIP8L2 MISSION shRNA Bacterial Glycerol Stock
tumor necrosis factor, alpha-induced protein 8-like 2
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000005670    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024575.1-178s1c1
Sequence:CCGGGTGGCTCATCTCTTCATAGATCTCGAGATCTATGAAGAGATGAGCCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005669    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024575.1-276s1c1
Sequence:CCGGCGTGATCAAGGACCTGATCAACTCGAGTTGATCAGGTCCTTGATCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005668    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024575.1-403s1c1
Sequence:CCGGGCACTTACCTTTGGTGAGGTACTCGAGTACCTCACCAAAGGTAAGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005671    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024575.1-625s1c1
Sequence:CCGGCTCAGGAAGCTGCTAGACGAACTCGAGTTCGTCTAGCAGCTTCCTGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005667    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024575.1-709s1c1
Sequence:CCGGCACAGATAATGGGCTTCCTAACTCGAGTTAGGAAGCCCATTATCTGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435958    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024575.3-779s21c1
Sequence:CCGGTTCAATCTTCAGGCTTCATTCCTCGAGGAATGAAGCCTGAAGATTGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426612    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024575.3-419s21c1
Sequence:CCGGCCATGACGGCACTTAGCTTTGCTCGAGCAAAGCTAAGTGCCGTCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427396    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024575.3-557s21c1
Sequence:CCGGGCCACGTGTTTGATCACTTCTCTCGAGAGAAGTGATCAAACACGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024575
TNFAIP8L2 MISSION shRNA shRNA Plasmid DNA
tumor necrosis factor, alpha-induced protein 8-like 2
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000005670    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024575.1-178s1c1
Sequence:CCGGGTGGCTCATCTCTTCATAGATCTCGAGATCTATGAAGAGATGAGCCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005669    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024575.1-276s1c1
Sequence:CCGGCGTGATCAAGGACCTGATCAACTCGAGTTGATCAGGTCCTTGATCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005668    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024575.1-403s1c1
Sequence:CCGGGCACTTACCTTTGGTGAGGTACTCGAGTACCTCACCAAAGGTAAGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005671    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024575.1-625s1c1
Sequence:CCGGCTCAGGAAGCTGCTAGACGAACTCGAGTTCGTCTAGCAGCTTCCTGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005667    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024575.1-709s1c1
Sequence:CCGGCACAGATAATGGGCTTCCTAACTCGAGTTAGGAAGCCCATTATCTGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435958    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024575.3-779s21c1
Sequence:CCGGTTCAATCTTCAGGCTTCATTCCTCGAGGAATGAAGCCTGAAGATTGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426612    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024575.3-419s21c1
Sequence:CCGGCCATGACGGCACTTAGCTTTGCTCGAGCAAAGCTAAGTGCCGTCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427396    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024575.3-557s21c1
Sequence:CCGGGCCACGTGTTTGATCACTTCTCTCGAGAGAAGTGATCAAACACGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024575
TNFAIP8L2 MISSION shRNA Lentiviral Transduction Particles
tumor necrosis factor, alpha-induced protein 8-like 2
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000005670    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024575.1-178s1c1
Sequence:CCGGGTGGCTCATCTCTTCATAGATCTCGAGATCTATGAAGAGATGAGCCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005669    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024575.1-276s1c1
Sequence:CCGGCGTGATCAAGGACCTGATCAACTCGAGTTGATCAGGTCCTTGATCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005668    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024575.1-403s1c1
Sequence:CCGGGCACTTACCTTTGGTGAGGTACTCGAGTACCTCACCAAAGGTAAGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005671    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024575.1-625s1c1
Sequence:CCGGCTCAGGAAGCTGCTAGACGAACTCGAGTTCGTCTAGCAGCTTCCTGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005667    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024575.1-709s1c1
Sequence:CCGGCACAGATAATGGGCTTCCTAACTCGAGTTAGGAAGCCCATTATCTGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435958    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024575.3-779s21c1
Sequence:CCGGTTCAATCTTCAGGCTTCATTCCTCGAGGAATGAAGCCTGAAGATTGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426612    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024575.3-419s21c1
Sequence:CCGGCCATGACGGCACTTAGCTTTGCTCGAGCAAAGCTAAGTGCCGTCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427396    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024575.3-557s21c1
Sequence:CCGGGCCACGTGTTTGATCACTTCTCTCGAGAGAAGTGATCAAACACGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks