EMAIL THIS PAGE TO A FRIEND

TNFAIP8L3

tumor necrosis factor, alpha-induced protein 8-like 3

UniProtKB ID: Q5GJ75, Q6ZWD1
Gene ID:
Mouse(244882) tumor necrosis factor, alpha-induced protein 8-like 3
Rat(315673) tumor necrosis factor, alpha-induced protein 8-like 3
Zebrafish(393322) tumor necrosis factor, alpha-induced protein 8-like 3
chicken(427499) tumor necrosis factor, alpha-induced protein 8-like 3
dog(487552) tumor necrosis factor, alpha-induced protein 8-like 3
domestic cat(101082827) tumor necrosis factor, alpha-induced protein 8-like 3
sheep(101107794) tumor necrosis factor, alpha-induced protein 8-like 3
domestic guinea pig(100717102) tumor necrosis factor, alpha-induced protein 8-like 3
naked mole-rat(101707980) tumor necrosis factor, alpha-induced protein 8-like 3
104 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001033535 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001033535 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001033535 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_207381 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_207381 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_207381 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU131611 MISSION® esiRNA esiRNA human TNFAIP8L3 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_207381 Rosetta Predictions human pricing
XM_001072284 Rosetta Predictions rat pricing
XM_236246 Rosetta Predictions rat pricing
NM_001033535 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207381 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00373987 predicted 1078
2 SASI_Hs01_00139967 predicted 450
3 SASI_Hs01_00139968 predicted 734
4 SASI_Hs01_00139969 predicted 840
5 SASI_Hs02_00373988 predicted 528
6 SASI_Hs01_00139970 predicted 634
7 SASI_Hs01_00139972 predicted 580
8 SASI_Hs01_00139973 predicted 1058
9 SASI_Hs01_00139974 predicted 1005
10 SASI_Hs01_00139976 predicted 1116
11 SASI_Hs01_00139971 predicted 1032
12 SASI_Hs01_00139975 predicted 944
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001072284 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00338530 predicted 554
2 SASI_Rn02_00338531 predicted 282
3 SASI_Rn02_00338532 predicted 554
4 SASI_Rn02_00338533 predicted 517
5 SASI_Rn02_00338534 predicted 402
6 SASI_Rn02_00338535 predicted 537
7 SASI_Rn02_00338536 predicted 335
8 SASI_Rn02_00338537 predicted 230
9 SASI_Rn02_00338538 predicted 420
10 SASI_Rn02_00338539 predicted 366
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_236246 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00389904 predicted 243
2 SASI_Rn02_00389905 predicted 628
3 SASI_Rn02_00389906 predicted 354
4 SASI_Rn02_00389907 predicted 627
5 SASI_Rn02_00389908 predicted 596
6 SASI_Rn02_00389909 predicted 479
7 SASI_Rn02_00389910 predicted 607
8 SASI_Rn02_00389911 predicted 406
9 SASI_Rn02_00389912 predicted 304
10 SASI_Rn02_00389913 predicted 486
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033535 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00288899 predicted 324
2 SASI_Mm01_00199965 predicted 515
3 SASI_Mm01_00199966 predicted 502
4 SASI_Mm01_00199967 predicted 830
5 SASI_Mm01_00199968 predicted 511
6 SASI_Mm01_00199969 predicted 377
7 SASI_Mm01_00199970 predicted 774
8 SASI_Mm01_00199971 predicted 702
9 SASI_Mm01_00199972 predicted 428
10 SASI_Mm01_00199973 predicted 615
11 SASI_Mm01_00199974 predicted 653
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001033535
TNFAIP8L3 MISSION shRNA Bacterial Glycerol Stock
tumor necrosis factor, alpha-induced protein 8-like 3
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000265370    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033535.3-1253s21c1
Sequence:CCGGGCTAGTTGTCATAGCATATTTCTCGAGAAATATGCTATGACAACTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253187    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033535.3-710s21c1
Sequence:CCGGGGATTTGCGAAGGAATCAATACTCGAGTATTGATTCCTTCGCAAATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253188    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033535.3-606s21c1
Sequence:CCGGCAGAACCCATGGACGCATAAACTCGAGTTTATGCGTCCATGGGTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253186    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033535.3-430s21c1
Sequence:CCGGTTCAGTCAAGAGGAGGTTATACTCGAGTATAACCTCCTCTTGACTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000265349    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033535.3-293s21c1
Sequence:CCGGACACCAGCAGTGAGATCTTTGCTCGAGCAAAGATCTCACTGCTGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001033535
TNFAIP8L3 MISSION shRNA shRNA Plasmid DNA
tumor necrosis factor, alpha-induced protein 8-like 3
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000265370    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033535.3-1253s21c1
Sequence:CCGGGCTAGTTGTCATAGCATATTTCTCGAGAAATATGCTATGACAACTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253187    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033535.3-710s21c1
Sequence:CCGGGGATTTGCGAAGGAATCAATACTCGAGTATTGATTCCTTCGCAAATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253188    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033535.3-606s21c1
Sequence:CCGGCAGAACCCATGGACGCATAAACTCGAGTTTATGCGTCCATGGGTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253186    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033535.3-430s21c1
Sequence:CCGGTTCAGTCAAGAGGAGGTTATACTCGAGTATAACCTCCTCTTGACTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000265349    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033535.3-293s21c1
Sequence:CCGGACACCAGCAGTGAGATCTTTGCTCGAGCAAAGATCTCACTGCTGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001033535
TNFAIP8L3 MISSION shRNA Lentiviral Transduction Particles
tumor necrosis factor, alpha-induced protein 8-like 3
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000265370    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033535.3-1253s21c1
Sequence:CCGGGCTAGTTGTCATAGCATATTTCTCGAGAAATATGCTATGACAACTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253187    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033535.3-710s21c1
Sequence:CCGGGGATTTGCGAAGGAATCAATACTCGAGTATTGATTCCTTCGCAAATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253188    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033535.3-606s21c1
Sequence:CCGGCAGAACCCATGGACGCATAAACTCGAGTTTATGCGTCCATGGGTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253186    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033535.3-430s21c1
Sequence:CCGGTTCAGTCAAGAGGAGGTTATACTCGAGTATAACCTCCTCTTGACTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000265349    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033535.3-293s21c1
Sequence:CCGGACACCAGCAGTGAGATCTTTGCTCGAGCAAAGATCTCACTGCTGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_207381
TNFAIP8L3 MISSION shRNA Bacterial Glycerol Stock
tumor necrosis factor, alpha-induced protein 8-like 3
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000149855    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207381.1-187s1c1
Sequence:CCGGCCAGAAGAAGATTCTGAGCAACTCGAGTTGCTCAGAATCTTCTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149407    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207381.1-584s1c1
Sequence:CCGGGTCTTTAACCACTTTGCCGATCTCGAGATCGGCAAAGTGGTTAAAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148046    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207381.1-688s1c1
Sequence:CCGGGCTAGATGAGAAAGTCCTTTACTCGAGTAAAGGACTTTCTCATCTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149338    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207381.1-397s1c1
Sequence:CCGGGCTGGTTATTGTGGAGAAGTTCTCGAGAACTTCTCCACAATAACCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130521    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207381.1-269s1c1
Sequence:CCGGGAGCTCTACAAAGTCACCAAACTCGAGTTTGGTGACTTTGTAGAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129681    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207381.1-316s1c1
Sequence:CCGGCCACAAGATCATGAAAGACTTCTCGAGAAGTCTTTCATGATCTTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129657    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207381.1-188s1c1
Sequence:CCGGCAGAAGAAGATTCTGAGCAAACTCGAGTTTGCTCAGAATCTTCTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_207381
TNFAIP8L3 MISSION shRNA shRNA Plasmid DNA
tumor necrosis factor, alpha-induced protein 8-like 3
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000149855    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207381.1-187s1c1
Sequence:CCGGCCAGAAGAAGATTCTGAGCAACTCGAGTTGCTCAGAATCTTCTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149407    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207381.1-584s1c1
Sequence:CCGGGTCTTTAACCACTTTGCCGATCTCGAGATCGGCAAAGTGGTTAAAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148046    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207381.1-688s1c1
Sequence:CCGGGCTAGATGAGAAAGTCCTTTACTCGAGTAAAGGACTTTCTCATCTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149338    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207381.1-397s1c1
Sequence:CCGGGCTGGTTATTGTGGAGAAGTTCTCGAGAACTTCTCCACAATAACCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130521    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207381.1-269s1c1
Sequence:CCGGGAGCTCTACAAAGTCACCAAACTCGAGTTTGGTGACTTTGTAGAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129681    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207381.1-316s1c1
Sequence:CCGGCCACAAGATCATGAAAGACTTCTCGAGAAGTCTTTCATGATCTTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129657    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207381.1-188s1c1
Sequence:CCGGCAGAAGAAGATTCTGAGCAAACTCGAGTTTGCTCAGAATCTTCTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_207381
TNFAIP8L3 MISSION shRNA Lentiviral Transduction Particles
tumor necrosis factor, alpha-induced protein 8-like 3
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000149855    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207381.1-187s1c1
Sequence:CCGGCCAGAAGAAGATTCTGAGCAACTCGAGTTGCTCAGAATCTTCTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149407    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207381.1-584s1c1
Sequence:CCGGGTCTTTAACCACTTTGCCGATCTCGAGATCGGCAAAGTGGTTAAAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148046    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207381.1-688s1c1
Sequence:CCGGGCTAGATGAGAAAGTCCTTTACTCGAGTAAAGGACTTTCTCATCTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149338    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207381.1-397s1c1
Sequence:CCGGGCTGGTTATTGTGGAGAAGTTCTCGAGAACTTCTCCACAATAACCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130521    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207381.1-269s1c1
Sequence:CCGGGAGCTCTACAAAGTCACCAAACTCGAGTTTGGTGACTTTGTAGAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129681    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207381.1-316s1c1
Sequence:CCGGCCACAAGATCATGAAAGACTTCTCGAGAAGTCTTTCATGATCTTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129657    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207381.1-188s1c1
Sequence:CCGGCAGAAGAAGATTCTGAGCAAACTCGAGTTTGCTCAGAATCTTCTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks