EMAIL THIS PAGE TO A FRIEND

TNFRSF10A

tumor necrosis factor receptor superfamily, member 10a

Synonyms: APO2 CD261 DR4 TRAILR-1 TRAILR1
UniProtKB ID: O00220, A8K5I4, Q53Y72, Q96E62
Gene ID:
Human(8797) Summary: The protein encoded by this gene is a member of the TNF-receptor superfamily. This receptor is activated by tumor necrosis factor-related apoptosis inducing ligand (TNFSF10/TRAIL), and thus transduces cell death signal and induces cell apoptosis. Studies with FADD-deficient mice suggested that FADD, a death domain containing adaptor protein, is required for the apoptosis mediated by this protein. [provided by RefSeq, Jul 2008]
cow(781763) tumor necrosis factor receptor superfamily, member 10a
domestic guinea pig(101787877) tumor necrosis factor receptor superfamily, member 10a
44 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4700541 Anti-CD261, low endotoxin antibody, Mouse monoclonal clone DR-4-02, purified immunoglobulin, buffered aqueous solution human
flow cytometry, immunocytochemistry, immunoprecipitation pricing
SAB3500428 Anti-DR4 antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
ELISA, immunocytochemistry, immunofluorescence, immunohistochemistry, western blot pricing
D3813 Anti-DR4, N-Terminal antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
microarray, western blot pricing
AV02065 Anti-TNFRSF10A antibody produced in rabbit IgG fraction of antiserum human
western blot pricing
HPA054475 Anti-TNFRSF10A antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
HPA050958 Anti-TNFRSF10A antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunofluorescence pricing
SAB4700542 Monoclonal Anti-CD261-FITC antibody produced in mouse clone DR-4-02, purified immunoglobulin, buffered aqueous solution human
flow cytometry pricing
SAB4700543 Monoclonal Anti-CD261-PE antibody produced in mouse clone DR-4-02, purified immunoglobulin, buffered aqueous solution human
flow cytometry pricing
WH0008797M1 Monoclonal Anti-TNFRSF10A antibody produced in mouse clone 2E8, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1404626 Monoclonal Anti-TNFRSF10A antibody produced in mouse clone 2E9, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing

ELISA

Product # Description Species Add to Cart
 
RAB0746 Human TNFRSF10A ELISA Kit human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003844 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003844 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003844 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU008861 MISSION® esiRNA esiRNA targeting human TNFRSF10A (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003844 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003844 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00139573 predicted 1277
2 SASI_Hs02_00336415 predicted 636
3 SASI_Hs01_00139575 predicted 757
4 SASI_Hs01_00139576 predicted 368
5 SASI_Hs01_00139577 predicted 391
6 SASI_Hs01_00139579 predicted 650
7 SASI_Hs01_00139580 predicted 1143
8 SASI_Hs01_00139581 predicted 1293
9 SASI_Hs01_00139582 predicted 1173
10 SASI_Hs02_00336416 predicted 895
11 SASI_Hs01_00139574 predicted 772
12 SASI_Hs01_00139578 predicted 1303
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003844
VALIDATED
TNFRSF10A MISSION shRNA Bacterial Glycerol Stock
tumor necrosis factor receptor superfamily, member 10a
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000005934    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003844.2-1499s1c1
Sequence:CCGGCTTAGGTGTTAGGAGTTAATACTCGAGTATTAACTCCTAACACCTAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005937    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003844.2-1415s1c1
Sequence:CCGGCTCTGGAAAGTTCATCTACTTCTCGAGAAGTAGATGAACTTTCCAGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005938    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003844.2-1157s1c1
Sequence:CCGGGATGCTGTTCTTTGACAAGTTCTCGAGAACTTGTCAAAGAACAGCATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005936    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003844.2-570s1c1
Sequence:CCGGGCTTGTAAATCAGATGAAGAACTCGAGTTCTTCATCTGATTTACAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005935    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_003844.2-421s1c1
Sequence:CCGGGCACACAGCAATGGGAACATACTCGAGTATGTTCCCATTGCTGTGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000355575    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003844.2-1498s21c1
Sequence:CCGGTCTTAGGTGTTAGGAGTTAATCTCGAGATTAACTCCTAACACCTAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000355576    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_003844.2-943s21c1
Sequence:CCGGACAATGCTCACAACGAGATTCCTCGAGGAATCTCGTTGTGAGCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000355577    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003844.2-764s21c1
Sequence:CCGGATCAGGCAATGGACATAATATCTCGAGATATTATGTCCATTGCCTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003844
VALIDATED
TNFRSF10A MISSION shRNA shRNA Plasmid DNA
tumor necrosis factor receptor superfamily, member 10a
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000005934    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003844.2-1499s1c1
Sequence:CCGGCTTAGGTGTTAGGAGTTAATACTCGAGTATTAACTCCTAACACCTAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005937    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003844.2-1415s1c1
Sequence:CCGGCTCTGGAAAGTTCATCTACTTCTCGAGAAGTAGATGAACTTTCCAGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005938    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003844.2-1157s1c1
Sequence:CCGGGATGCTGTTCTTTGACAAGTTCTCGAGAACTTGTCAAAGAACAGCATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005936    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003844.2-570s1c1
Sequence:CCGGGCTTGTAAATCAGATGAAGAACTCGAGTTCTTCATCTGATTTACAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005935    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_003844.2-421s1c1
Sequence:CCGGGCACACAGCAATGGGAACATACTCGAGTATGTTCCCATTGCTGTGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000355575    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003844.2-1498s21c1
Sequence:CCGGTCTTAGGTGTTAGGAGTTAATCTCGAGATTAACTCCTAACACCTAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000355576    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_003844.2-943s21c1
Sequence:CCGGACAATGCTCACAACGAGATTCCTCGAGGAATCTCGTTGTGAGCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000355577    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003844.2-764s21c1
Sequence:CCGGATCAGGCAATGGACATAATATCTCGAGATATTATGTCCATTGCCTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003844
VALIDATED
TNFRSF10A MISSION shRNA Lentiviral Transduction Particles
tumor necrosis factor receptor superfamily, member 10a
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000005934    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003844.2-1499s1c1
Sequence:CCGGCTTAGGTGTTAGGAGTTAATACTCGAGTATTAACTCCTAACACCTAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005937    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003844.2-1415s1c1
Sequence:CCGGCTCTGGAAAGTTCATCTACTTCTCGAGAAGTAGATGAACTTTCCAGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005938    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003844.2-1157s1c1
Sequence:CCGGGATGCTGTTCTTTGACAAGTTCTCGAGAACTTGTCAAAGAACAGCATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005936    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003844.2-570s1c1
Sequence:CCGGGCTTGTAAATCAGATGAAGAACTCGAGTTCTTCATCTGATTTACAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005935    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_003844.2-421s1c1
Sequence:CCGGGCACACAGCAATGGGAACATACTCGAGTATGTTCCCATTGCTGTGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000355575    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003844.2-1498s21c1
Sequence:CCGGTCTTAGGTGTTAGGAGTTAATCTCGAGATTAACTCCTAACACCTAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000355576    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_003844.2-943s21c1
Sequence:CCGGACAATGCTCACAACGAGATTCCTCGAGGAATCTCGTTGTGAGCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000355577    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003844.2-764s21c1
Sequence:CCGGATCAGGCAATGGACATAATATCTCGAGATATTATGTCCATTGCCTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks