EMAIL THIS PAGE TO A FRIEND

TNFRSF10B

tumor necrosis factor receptor superfamily, member 10b

Synonyms: CD262 DR5 KILLER KILLER/DR5 TRAIL-R2 TRAILR2 TRICK2 TRICK2A TRICK2B TRICKB ZTNFR9
Gene ID:
Human(8795) Summary: The protein encoded by this gene is a member of the TNF-receptor superfamily, and contains an intracellular death domain. This receptor can be activated by tumor necrosis factor-related apoptosis inducing ligand (TNFSF10/TRAIL/APO-2L), and transduces an apoptosis signal. Studies with FADD-deficient mice suggested that FADD, a death domain containing adaptor protein, is required for the apoptosis mediated by this protein. Two transcript variants encoding different isoforms and one non-coding transcript have been found for this gene. [provided by RefSeq, Mar 2009]
Mouse(21933) tumor necrosis factor receptor superfamily, member 10b
Rat(364420) tumor necrosis factor receptor superfamily, member 10b
chicken(373904) tumor necrosis factor receptor superfamily, member 10b
naked mole-rat(101697353) tumor necrosis factor receptor superfamily, member 10b
cow(282533) tumor necrosis factor receptor superfamily, member 10b
cow(784541) tumor necrosis factor receptor superfamily, member 10b
94 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003842 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003842 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003842 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_020275 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_020275 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_020275 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003842 siRNAs that have been validated in the lab human pricing
NM_147187 Rosetta Predictions human pricing
NM_001108873 Rosetta Predictions rat pricing
NM_020275 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003842 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00040567 validated 1442
2 SASI_Hs01_00040569 predicted 1749
3 SASI_Hs01_00040570 predicted 584
4 SASI_Hs01_00040571 predicted 1300
5 SASI_Hs01_00040573 predicted 1280
6 SASI_Hs02_00336412 predicted 1661
7 SASI_Hs01_00040574 predicted 1716
8 SASI_Hs01_00040575 predicted 536
9 SASI_Hs01_00040576 predicted 1569
10 SASI_Hs02_00336413 predicted 1321
11 SASI_Hs01_00040568 predicted 1684
12 SASI_Hs01_00040572 predicted 1376
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_147187 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00154854 predicted 1346
2 SASI_Hs01_00154856 predicted 1663
3 SASI_Hs01_00154857 predicted 579
4 SASI_Hs01_00154858 predicted 1213
5 SASI_Hs01_00154860 predicted 1191
6 SASI_Hs02_00365527 predicted 1572
7 SASI_Hs01_00154861 predicted 1634
8 SASI_Hs01_00154862 predicted 536
9 SASI_Hs01_00154863 predicted 1479
10 SASI_Hs02_00365528 predicted 1233
11 SASI_Hs01_00154855 predicted 1594
12 SASI_Hs01_00154859 predicted 1282
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108873 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00242925 predicted 578
2 SASI_Rn02_00242926 predicted 826
3 SASI_Rn02_00242927 predicted 806
4 SASI_Rn02_00242928 predicted 1017
5 SASI_Rn02_00242929 predicted 679
6 SASI_Rn02_00242930 predicted 994
7 SASI_Rn02_00242931 predicted 519
8 SASI_Rn02_00242932 predicted 864
9 SASI_Rn02_00242933 predicted 647
10 SASI_Rn02_00242934 predicted 384
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020275 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00325467 predicted 1195
2 SASI_Mm02_00325468 predicted 561
3 SASI_Mm02_00325469 predicted 1283
4 SASI_Mm02_00325470 predicted 1342
5 SASI_Mm02_00325471 predicted 1331
6 SASI_Mm02_00325472 predicted 277
7 SASI_Mm02_00325473 predicted 844
8 SASI_Mm02_00325474 predicted 953
9 SASI_Mm02_00325475 predicted 800
10 SASI_Mm02_00325476 predicted 895
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003842
VALIDATED
TNFRSF10B MISSION shRNA Bacterial Glycerol Stock
tumor necrosis factor receptor superfamily, member 10b
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000279825    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003842.3-2656s21c1
Sequence:CCGGGCAGTCTCATTTGCACCCATACTCGAGTATGGGTGCAAATGAGACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000279826    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003842.3-822s21c1
Sequence:CCGGCCACAAAGAATCAGGTACAAACTCGAGTTTGTACCTGATTCTTTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000279755    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003842.3-1530s21c1
Sequence:CCGGGCAGAAGATTGAGGACCACTTCTCGAGAAGTGGTCCTCAATCTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000279756    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003842.3-599s21c1
Sequence:CCGGCTCACTGGAATGACCTCCTTTCTCGAGAAAGGAGGTCATTCCAGTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005929    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_003842.3-2656s1c1
Sequence:CCGGGCAGTCTCATTTGCACCCATACTCGAGTATGGGTGCAAATGAGACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005931    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003842.3-1084s1c1
Sequence:CCGGGCTGAGGACAATGTCCTCAATCTCGAGATTGAGGACATTGTCCTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005932    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_003842.3-599s1c1
Sequence:CCGGCTCACTGGAATGACCTCCTTTCTCGAGAAAGGAGGTCATTCCAGTGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005930    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_003842.3-822s1c1
Sequence:CCGGCCACAAAGAATCAGGTACAAACTCGAGTTTGTACCTGATTCTTTGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005933    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_003842.3-1530s1c1
Sequence:CCGGGCAGAAGATTGAGGACCACTTCTCGAGAAGTGGTCCTCAATCTTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003842
VALIDATED
TNFRSF10B MISSION shRNA shRNA Plasmid DNA
tumor necrosis factor receptor superfamily, member 10b
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000279825    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003842.3-2656s21c1
Sequence:CCGGGCAGTCTCATTTGCACCCATACTCGAGTATGGGTGCAAATGAGACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000279826    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003842.3-822s21c1
Sequence:CCGGCCACAAAGAATCAGGTACAAACTCGAGTTTGTACCTGATTCTTTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000279755    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003842.3-1530s21c1
Sequence:CCGGGCAGAAGATTGAGGACCACTTCTCGAGAAGTGGTCCTCAATCTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000279756    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003842.3-599s21c1
Sequence:CCGGCTCACTGGAATGACCTCCTTTCTCGAGAAAGGAGGTCATTCCAGTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005929    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_003842.3-2656s1c1
Sequence:CCGGGCAGTCTCATTTGCACCCATACTCGAGTATGGGTGCAAATGAGACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005931    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003842.3-1084s1c1
Sequence:CCGGGCTGAGGACAATGTCCTCAATCTCGAGATTGAGGACATTGTCCTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005932    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_003842.3-599s1c1
Sequence:CCGGCTCACTGGAATGACCTCCTTTCTCGAGAAAGGAGGTCATTCCAGTGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005930    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_003842.3-822s1c1
Sequence:CCGGCCACAAAGAATCAGGTACAAACTCGAGTTTGTACCTGATTCTTTGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005933    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_003842.3-1530s1c1
Sequence:CCGGGCAGAAGATTGAGGACCACTTCTCGAGAAGTGGTCCTCAATCTTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003842
VALIDATED
TNFRSF10B MISSION shRNA Lentiviral Transduction Particles
tumor necrosis factor receptor superfamily, member 10b
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000279825    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003842.3-2656s21c1
Sequence:CCGGGCAGTCTCATTTGCACCCATACTCGAGTATGGGTGCAAATGAGACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000279826    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003842.3-822s21c1
Sequence:CCGGCCACAAAGAATCAGGTACAAACTCGAGTTTGTACCTGATTCTTTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000279755    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003842.3-1530s21c1
Sequence:CCGGGCAGAAGATTGAGGACCACTTCTCGAGAAGTGGTCCTCAATCTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000279756    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003842.3-599s21c1
Sequence:CCGGCTCACTGGAATGACCTCCTTTCTCGAGAAAGGAGGTCATTCCAGTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005929    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_003842.3-2656s1c1
Sequence:CCGGGCAGTCTCATTTGCACCCATACTCGAGTATGGGTGCAAATGAGACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005931    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003842.3-1084s1c1
Sequence:CCGGGCTGAGGACAATGTCCTCAATCTCGAGATTGAGGACATTGTCCTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005932    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_003842.3-599s1c1
Sequence:CCGGCTCACTGGAATGACCTCCTTTCTCGAGAAAGGAGGTCATTCCAGTGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005930    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_003842.3-822s1c1
Sequence:CCGGCCACAAAGAATCAGGTACAAACTCGAGTTTGTACCTGATTCTTTGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005933    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_003842.3-1530s1c1
Sequence:CCGGGCAGAAGATTGAGGACCACTTCTCGAGAAGTGGTCCTCAATCTTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020275
VALIDATED
TNFRSF10B MISSION shRNA Bacterial Glycerol Stock
tumor necrosis factor receptor superfamily, member 10b
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000012324    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020275.3-1208s1c1
Sequence:CCGGCGGGAGGTTTACTTATCAGAACTCGAGTTCTGATAAGTAAACCTCCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012325    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020275.3-488s1c1
Sequence:CCGGCCGATGCAACATAACCACAAACTCGAGTTTGTGGTTATGTTGCATCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012326    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020275.3-528s1c1
Sequence:CCGGCCAGGCACCTTTGAAGATAAACTCGAGTTTATCTTCAAAGGTGCCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012327    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020275.3-454s1c1
Sequence:CCGGGCACAGTCTGTAAGGAAGATACTCGAGTATCTTCCTTACAGACTGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012323    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020275.3-1344s1c1
Sequence:CCGGGCTCTTCAGTATTATGAGAATCTCGAGATTCTCATAATACTGAAGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020275
VALIDATED
TNFRSF10B MISSION shRNA shRNA Plasmid DNA
tumor necrosis factor receptor superfamily, member 10b
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000012324    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020275.3-1208s1c1
Sequence:CCGGCGGGAGGTTTACTTATCAGAACTCGAGTTCTGATAAGTAAACCTCCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012325    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020275.3-488s1c1
Sequence:CCGGCCGATGCAACATAACCACAAACTCGAGTTTGTGGTTATGTTGCATCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012326    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020275.3-528s1c1
Sequence:CCGGCCAGGCACCTTTGAAGATAAACTCGAGTTTATCTTCAAAGGTGCCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012327    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020275.3-454s1c1
Sequence:CCGGGCACAGTCTGTAAGGAAGATACTCGAGTATCTTCCTTACAGACTGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012323    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020275.3-1344s1c1
Sequence:CCGGGCTCTTCAGTATTATGAGAATCTCGAGATTCTCATAATACTGAAGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020275
VALIDATED
TNFRSF10B MISSION shRNA Lentiviral Transduction Particles
tumor necrosis factor receptor superfamily, member 10b
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000012324    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020275.3-1208s1c1
Sequence:CCGGCGGGAGGTTTACTTATCAGAACTCGAGTTCTGATAAGTAAACCTCCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012325    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020275.3-488s1c1
Sequence:CCGGCCGATGCAACATAACCACAAACTCGAGTTTGTGGTTATGTTGCATCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012326    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020275.3-528s1c1
Sequence:CCGGCCAGGCACCTTTGAAGATAAACTCGAGTTTATCTTCAAAGGTGCCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012327    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020275.3-454s1c1
Sequence:CCGGGCACAGTCTGTAAGGAAGATACTCGAGTATCTTCCTTACAGACTGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012323    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020275.3-1344s1c1
Sequence:CCGGGCTCTTCAGTATTATGAGAATCTCGAGATTCTCATAATACTGAAGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks