EMAIL THIS PAGE TO A FRIEND

TNFRSF10C

tumor necrosis factor receptor superfamily, member 10c, decoy without an intracellular domain

Synonyms: CD263 DCR1 DCR1-TNFR LIT TRAIL-R3 TRAILR3 TRID
Species: Human TNFRSF10C(8794)
UniProtKB ID: O14798, O14755, Q08AS6, Q6FH98, Q6UXM5
Gene ID:
Human(8794) Summary: The protein encoded by this gene is a member of the TNF-receptor superfamily. This receptor contains an extracellular TRAIL-binding domain and a transmembrane domain, but no cytoplasmic death domain. This receptor is not capable of inducing apoptosis, and is thought to function as an antagonistic receptor that protects cells from TRAIL-induced apoptosis. This gene was found to be a p53-regulated DNA damage-inducible gene. The expression of this gene was detected in many normal tissues but not in most cancer cell lines, which may explain the specific sensitivity of cancer cells to the apoptosis-inducing activity of TRAIL. [provided by RefSeq, Jul 2008]
28 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003841 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003841 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003841 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU097041 MISSION® esiRNA esiRNA human TNFRSF10C (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003841 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003841 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00202637 predicted 981
2 SASI_Hs01_00202638 predicted 213
3 SASI_Hs01_00202639 predicted 939
4 SASI_Hs01_00202640 predicted 966
5 SASI_Hs01_00202641 predicted 438
6 SASI_Hs01_00202642 predicted 625
7 SASI_Hs01_00202643 predicted 1137
8 SASI_Hs01_00202644 predicted 1136
9 SASI_Hs01_00202645 predicted 607
10 SASI_Hs01_00202646 predicted 649
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003841
TNFRSF10C MISSION shRNA Bacterial Glycerol Stock
tumor necrosis factor receptor superfamily, member 10c, decoy without an intracellular domain
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000059248    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003841.2-936s1c1
Sequence:CCGGCGTAGGGATCATAGTTCTAATCTCGAGATTAGAACTATGATCCCTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059249    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003841.2-434s1c1
Sequence:CCGGCTTCCAACAATGAACCTTCTTCTCGAGAAGAAGGTTCATTGTTGGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059250    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003841.2-649s1c1
Sequence:CCGGGTTGAAGAATTTGGTGCCAATCTCGAGATTGGCACCAAATTCTTCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059251    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003841.2-949s1c1
Sequence:CCGGGTTCTAATTGTGCTTCTGATTCTCGAGAATCAGAAGCACAATTAGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059252    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003841.2-615s1c1
Sequence:CCGGCAGTAATTGTACGTCCTGGGACTCGAGTCCCAGGACGTACAATTACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000443810    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003841.2-257s21c1
Sequence:CCGGTGCCAGTCCTAGCTTACTCTGCTCGAGCAGAGTAAGCTAGGACTGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426354    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003841.2-690s21c1
Sequence:CCGGTGCTGAAGAGACAATGAACACCTCGAGGTGTTCATTGTCTCTTCAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417499    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003841.2-1085s21c1
Sequence:CCGGTGTGTTCCCACAGACAGAAACCTCGAGGTTTCTGTCTGTGGGAACACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003841
TNFRSF10C MISSION shRNA shRNA Plasmid DNA
tumor necrosis factor receptor superfamily, member 10c, decoy without an intracellular domain
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000059248    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003841.2-936s1c1
Sequence:CCGGCGTAGGGATCATAGTTCTAATCTCGAGATTAGAACTATGATCCCTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059249    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003841.2-434s1c1
Sequence:CCGGCTTCCAACAATGAACCTTCTTCTCGAGAAGAAGGTTCATTGTTGGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059250    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003841.2-649s1c1
Sequence:CCGGGTTGAAGAATTTGGTGCCAATCTCGAGATTGGCACCAAATTCTTCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059251    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003841.2-949s1c1
Sequence:CCGGGTTCTAATTGTGCTTCTGATTCTCGAGAATCAGAAGCACAATTAGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059252    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003841.2-615s1c1
Sequence:CCGGCAGTAATTGTACGTCCTGGGACTCGAGTCCCAGGACGTACAATTACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000443810    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003841.2-257s21c1
Sequence:CCGGTGCCAGTCCTAGCTTACTCTGCTCGAGCAGAGTAAGCTAGGACTGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426354    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003841.2-690s21c1
Sequence:CCGGTGCTGAAGAGACAATGAACACCTCGAGGTGTTCATTGTCTCTTCAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417499    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003841.2-1085s21c1
Sequence:CCGGTGTGTTCCCACAGACAGAAACCTCGAGGTTTCTGTCTGTGGGAACACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003841
TNFRSF10C MISSION shRNA Lentiviral Transduction Particles
tumor necrosis factor receptor superfamily, member 10c, decoy without an intracellular domain
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000059248    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003841.2-936s1c1
Sequence:CCGGCGTAGGGATCATAGTTCTAATCTCGAGATTAGAACTATGATCCCTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059249    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003841.2-434s1c1
Sequence:CCGGCTTCCAACAATGAACCTTCTTCTCGAGAAGAAGGTTCATTGTTGGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059250    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003841.2-649s1c1
Sequence:CCGGGTTGAAGAATTTGGTGCCAATCTCGAGATTGGCACCAAATTCTTCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059251    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003841.2-949s1c1
Sequence:CCGGGTTCTAATTGTGCTTCTGATTCTCGAGAATCAGAAGCACAATTAGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059252    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003841.2-615s1c1
Sequence:CCGGCAGTAATTGTACGTCCTGGGACTCGAGTCCCAGGACGTACAATTACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000443810    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003841.2-257s21c1
Sequence:CCGGTGCCAGTCCTAGCTTACTCTGCTCGAGCAGAGTAAGCTAGGACTGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426354    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003841.2-690s21c1
Sequence:CCGGTGCTGAAGAGACAATGAACACCTCGAGGTGTTCATTGTCTCTTCAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417499    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003841.2-1085s21c1
Sequence:CCGGTGTGTTCCCACAGACAGAAACCTCGAGGTTTCTGTCTGTGGGAACACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks