EMAIL THIS PAGE TO A FRIEND

TNFRSF10D

tumor necrosis factor receptor superfamily, member 10d, decoy with truncated death domain

Synonyms: CD264 DCR2 TRAIL-R4 TRAILR4 TRUNDD
UniProtKB ID: Q9UBN6, B2R8W0, Q9Y6Q4
Gene ID:
Human(8793) Summary: The protein encoded by this gene is a member of the TNF-receptor superfamily. This receptor contains an extracellular TRAIL-binding domain, a transmembrane domain, and a truncated cytoplamic death domain. This receptor does not induce apoptosis, and has been shown to play an inhibitory role in TRAIL-induced cell apoptosis. [provided by RefSeq, Jul 2008]
cow(782274) tumor necrosis factor receptor superfamily, member 10d, decoy with truncated death domain
30 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003840 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003840 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003840 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU143961 MISSION® esiRNA esiRNA human TNFRSF10D (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003840 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003840 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00079719 predicted 711
2 SASI_Hs01_00079720 predicted 953
3 SASI_Hs01_00079721 predicted 918
4 SASI_Hs01_00079722 predicted 997
5 SASI_Hs01_00079723 predicted 579
6 SASI_Hs01_00079724 predicted 711
7 SASI_Hs01_00079725 predicted 407
8 SASI_Hs01_00079726 predicted 578
9 SASI_Hs01_00079728 predicted 1179
10 SASI_Hs02_00336411 predicted 431
11 SASI_Hs01_00079727 predicted 822
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003840
TNFRSF10D MISSION shRNA Bacterial Glycerol Stock
tumor necrosis factor receptor superfamily, member 10d, decoy with truncated death domain
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000423221    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003840.3-587s21c1
Sequence:CCGGGATGGTCAAGGTCAGTAATTGCTCGAGCAATTACTGACCTTGACCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413201    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003840.3-1353s21c1
Sequence:CCGGACAAACTCTACTATCCAATATCTCGAGATATTGGATAGTAGAGTTTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413561    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003840.3-1405s21c1
Sequence:CCGGTTAACGCACTTGGAGTAATTTCTCGAGAAATTACTCCAAGTGCGTTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058943    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003840.3-923s1c1
Sequence:CCGGCGAGACCCTGAGTAACAGATACTCGAGTATCTGTTACTCAGGGTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058947    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003840.3-200s1c1
Sequence:CCGGGATCCTTAAGTTCGTCGTCTTCTCGAGAAGACGACGAACTTAAGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058946    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003840.3-437s1c1
Sequence:CCGGCCTGCTATGTACAGTTTGTAACTCGAGTTACAAACTGTACATAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058944    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003840.3-712s1c1
Sequence:CCGGCCTCTCCCTATCACTACCTTACTCGAGTAAGGTAGTGATAGGGAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058945    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003840.3-415s1c1
Sequence:CCGGCTTCCAACAATTTGCCTTCTTCTCGAGAAGAAGGCAAATTGTTGGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003840
TNFRSF10D MISSION shRNA shRNA Plasmid DNA
tumor necrosis factor receptor superfamily, member 10d, decoy with truncated death domain
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000423221    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003840.3-587s21c1
Sequence:CCGGGATGGTCAAGGTCAGTAATTGCTCGAGCAATTACTGACCTTGACCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413201    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003840.3-1353s21c1
Sequence:CCGGACAAACTCTACTATCCAATATCTCGAGATATTGGATAGTAGAGTTTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413561    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003840.3-1405s21c1
Sequence:CCGGTTAACGCACTTGGAGTAATTTCTCGAGAAATTACTCCAAGTGCGTTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058943    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003840.3-923s1c1
Sequence:CCGGCGAGACCCTGAGTAACAGATACTCGAGTATCTGTTACTCAGGGTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058947    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003840.3-200s1c1
Sequence:CCGGGATCCTTAAGTTCGTCGTCTTCTCGAGAAGACGACGAACTTAAGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058946    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003840.3-437s1c1
Sequence:CCGGCCTGCTATGTACAGTTTGTAACTCGAGTTACAAACTGTACATAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058944    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003840.3-712s1c1
Sequence:CCGGCCTCTCCCTATCACTACCTTACTCGAGTAAGGTAGTGATAGGGAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058945    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003840.3-415s1c1
Sequence:CCGGCTTCCAACAATTTGCCTTCTTCTCGAGAAGAAGGCAAATTGTTGGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003840
TNFRSF10D MISSION shRNA Lentiviral Transduction Particles
tumor necrosis factor receptor superfamily, member 10d, decoy with truncated death domain
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000423221    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003840.3-587s21c1
Sequence:CCGGGATGGTCAAGGTCAGTAATTGCTCGAGCAATTACTGACCTTGACCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413201    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003840.3-1353s21c1
Sequence:CCGGACAAACTCTACTATCCAATATCTCGAGATATTGGATAGTAGAGTTTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413561    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003840.3-1405s21c1
Sequence:CCGGTTAACGCACTTGGAGTAATTTCTCGAGAAATTACTCCAAGTGCGTTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058943    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003840.3-923s1c1
Sequence:CCGGCGAGACCCTGAGTAACAGATACTCGAGTATCTGTTACTCAGGGTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058947    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003840.3-200s1c1
Sequence:CCGGGATCCTTAAGTTCGTCGTCTTCTCGAGAAGACGACGAACTTAAGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058946    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003840.3-437s1c1
Sequence:CCGGCCTGCTATGTACAGTTTGTAACTCGAGTTACAAACTGTACATAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058944    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003840.3-712s1c1
Sequence:CCGGCCTCTCCCTATCACTACCTTACTCGAGTAAGGTAGTGATAGGGAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058945    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003840.3-415s1c1
Sequence:CCGGCTTCCAACAATTTGCCTTCTTCTCGAGAAGAAGGCAAATTGTTGGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks