EMAIL THIS PAGE TO A FRIEND

TNFRSF11A

tumor necrosis factor receptor superfamily, member 11a, NFKB activator

Synonyms: CD265 FEO LOH18CR1 ODFR OFE OPTB7 OSTS PDB2 RANK TRANCER
UniProtKB ID: Q9Y6Q6, I4EC39
Gene ID:
Human(8792) Summary: The protein encoded by this gene is a member of the TNF-receptor superfamily. This receptors can interact with various TRAF family proteins, through which this receptor induces the activation of NF-kappa B and MAPK8/JNK. This receptor and its ligand are important regulators of the interaction between T cells and dendritic cells. This receptor is also an essential mediator for osteoclast and lymph node development. Mutations at this locus have been associated with familial expansile osteolysis, autosomal recessive osteopetrosis, and Paget disease of bone. Alternatively spliced transcript variants have been described for this locus. [provided by RefSeq, Aug 2012]
Mouse(21934) tumor necrosis factor receptor superfamily, member 11a
Rat(498206) tumor necrosis factor receptor superfamily, member 11a, NFKB activator
cow(530884) tumor necrosis factor receptor superfamily, member 11a, NFKB activator
sheep(101118842) tumor necrosis factor receptor superfamily, member 11a, NFKB activator
naked mole-rat(101718050) tumor necrosis factor receptor superfamily, member 11a, NFKB activator
Domestic Rabbit(100358260) tumor necrosis factor receptor superfamily, member 11a, NFKB activator
domestic guinea pig(100724119) tumor necrosis factor receptor superfamily, member 11a, NFKB activator
chicken(769909) tumor necrosis factor receptor superfamily, member 11a, NFKB activator
dog(483957) tumor necrosis factor receptor superfamily, member 11a, NFKB activator
domestic cat(101090651) tumor necrosis factor receptor superfamily, member 11a, NFKB activator
76 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0924 AQUA Peptide NTECAPGFGAQHPLQLN[K] mouse pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003839 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003839 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003839 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009399 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009399 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009399 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003839 Rosetta Predictions human pricing
XM_001063501 Rosetta Predictions rat pricing
XM_573424 Rosetta Predictions rat pricing
NM_009399 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003839 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00186225 predicted 655
2 SASI_Hs01_00186226 predicted 888
3 SASI_Hs01_00186227 predicted 290
4 SASI_Hs01_00186228 predicted 658
5 SASI_Hs01_00186229 predicted 284
6 SASI_Hs01_00186230 predicted 747
7 SASI_Hs01_00186231 predicted 758
8 SASI_Hs01_00186232 predicted 506
9 SASI_Hs01_00186233 predicted 505
10 SASI_Hs02_00336410 predicted 595
11 SASI_Hs01_00186234 predicted 723
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001063501 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00307346 predicted 864
2 SASI_Rn02_00307347 predicted 770
3 SASI_Rn02_00307348 predicted 1629
4 SASI_Rn02_00307349 predicted 1918
5 SASI_Rn02_00307350 predicted 1956
6 SASI_Rn02_00307351 predicted 1073
7 SASI_Rn02_00307352 predicted 646
8 SASI_Rn02_00307353 predicted 442
9 SASI_Rn02_00307354 predicted 978
10 SASI_Rn02_00307355 predicted 1580
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_573424 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00400283 predicted 867
2 SASI_Rn02_00400284 predicted 774
3 SASI_Rn02_00400285 predicted 868
4 SASI_Rn02_00400286 predicted 1627
5 SASI_Rn02_00400287 predicted 1081
6 SASI_Rn02_00400288 predicted 1157
7 SASI_Rn02_00400289 predicted 647
8 SASI_Rn02_00400290 predicted 440
9 SASI_Rn02_00400291 predicted 977
10 SASI_Rn02_00400292 predicted 1581
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009399 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00194529 predicted 872
2 SASI_Mm01_00194530 predicted 772
3 SASI_Mm01_00194531 predicted 858
4 SASI_Mm01_00194532 predicted 874
5 SASI_Mm01_00194533 predicted 277
6 SASI_Mm01_00194535 predicted 1897
7 SASI_Mm02_00316031 predicted 754
8 SASI_Mm01_00194536 predicted 688
9 SASI_Mm01_00194537 predicted 698
10 SASI_Mm01_00194538 predicted 778
11 SASI_Mm01_00194534 predicted 1041
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003839
TNFRSF11A MISSION shRNA Bacterial Glycerol Stock
tumor necrosis factor receptor superfamily, member 11a, NFKB activator
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000003348    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003839.x-924s1c1
Sequence:CCGGCCAGAAGATATGTGCTACCCACTCGAGTGGGTAGCACATATCTTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003350    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003839.x-659s1c1
Sequence:CCGGCCATGTTTACTTGCCCGGTTTCTCGAGAAACCGGGCAAGTAAACATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003349    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003839.x-1067s1c1
Sequence:CCGGGCCCACAGAAGATGAATACATCTCGAGATGTATTCATCTTCTGTGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003351    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003839.x-2696s1c1
Sequence:CCGGCCAGTGTGTGTTCATTGTAAACTCGAGTTTACAATGAACACACACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003352    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003839.x-253s1c1
Sequence:CCGGGCCCGGATGAATACTTGGATACTCGAGTATCCAAGTATTCATCCGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000377209    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003839.2-166s21c1
Sequence:CCGGTGGGACGGTGCTGTAACAAATCTCGAGATTTGTTACAGCACCGTCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000367440    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003839.2-755s21c1
Sequence:CCGGGAAAGCACTCACAGCTAATTTCTCGAGAAATTAGCTGTGAGTGCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356074    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003839.2-138s21c1
Sequence:CCGGTGTACCAGTGAGAAGCATTATCTCGAGATAATGCTTCTCACTGGTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000367374    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003839.2-662s21c1
Sequence:CCGGTGTTTACTTGCCCGGTTTAATCTCGAGATTAAACCGGGCAAGTAAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003839
TNFRSF11A MISSION shRNA shRNA Plasmid DNA
tumor necrosis factor receptor superfamily, member 11a, NFKB activator
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000003348    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003839.x-924s1c1
Sequence:CCGGCCAGAAGATATGTGCTACCCACTCGAGTGGGTAGCACATATCTTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003350    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003839.x-659s1c1
Sequence:CCGGCCATGTTTACTTGCCCGGTTTCTCGAGAAACCGGGCAAGTAAACATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003349    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003839.x-1067s1c1
Sequence:CCGGGCCCACAGAAGATGAATACATCTCGAGATGTATTCATCTTCTGTGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003351    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003839.x-2696s1c1
Sequence:CCGGCCAGTGTGTGTTCATTGTAAACTCGAGTTTACAATGAACACACACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003352    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003839.x-253s1c1
Sequence:CCGGGCCCGGATGAATACTTGGATACTCGAGTATCCAAGTATTCATCCGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000377209    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003839.2-166s21c1
Sequence:CCGGTGGGACGGTGCTGTAACAAATCTCGAGATTTGTTACAGCACCGTCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000367440    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003839.2-755s21c1
Sequence:CCGGGAAAGCACTCACAGCTAATTTCTCGAGAAATTAGCTGTGAGTGCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356074    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003839.2-138s21c1
Sequence:CCGGTGTACCAGTGAGAAGCATTATCTCGAGATAATGCTTCTCACTGGTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000367374    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003839.2-662s21c1
Sequence:CCGGTGTTTACTTGCCCGGTTTAATCTCGAGATTAAACCGGGCAAGTAAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003839
TNFRSF11A MISSION shRNA Lentiviral Transduction Particles
tumor necrosis factor receptor superfamily, member 11a, NFKB activator
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000003348    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003839.x-924s1c1
Sequence:CCGGCCAGAAGATATGTGCTACCCACTCGAGTGGGTAGCACATATCTTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003350    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003839.x-659s1c1
Sequence:CCGGCCATGTTTACTTGCCCGGTTTCTCGAGAAACCGGGCAAGTAAACATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003349    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003839.x-1067s1c1
Sequence:CCGGGCCCACAGAAGATGAATACATCTCGAGATGTATTCATCTTCTGTGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003351    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003839.x-2696s1c1
Sequence:CCGGCCAGTGTGTGTTCATTGTAAACTCGAGTTTACAATGAACACACACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003352    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003839.x-253s1c1
Sequence:CCGGGCCCGGATGAATACTTGGATACTCGAGTATCCAAGTATTCATCCGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000377209    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003839.2-166s21c1
Sequence:CCGGTGGGACGGTGCTGTAACAAATCTCGAGATTTGTTACAGCACCGTCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000367440    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003839.2-755s21c1
Sequence:CCGGGAAAGCACTCACAGCTAATTTCTCGAGAAATTAGCTGTGAGTGCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356074    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003839.2-138s21c1
Sequence:CCGGTGTACCAGTGAGAAGCATTATCTCGAGATAATGCTTCTCACTGGTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000367374    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003839.2-662s21c1
Sequence:CCGGTGTTTACTTGCCCGGTTTAATCTCGAGATTAAACCGGGCAAGTAAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009399
TNFRSF11A MISSION shRNA Bacterial Glycerol Stock
tumor necrosis factor receptor superfamily, member 11a, NFKB activator
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000065698    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009399.2-790s1c1
Sequence:CCGGGCAGTAGTCTAAGTGGAAATACTCGAGTATTTCCACTTAGACTACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065699    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009399.2-1163s1c1
Sequence:CCGGCGACAGTTTAAGCCAGTGTTTCTCGAGAAACACTGGCTTAAACTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065700    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009399.2-1106s1c1
Sequence:CCGGCCAGCAGGGAAGCAAATCTATCTCGAGATAGATTTGCTTCCCTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065702    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009399.2-279s1c1
Sequence:CCGGGATAAATGCTTGCTGCATAAACTCGAGTTTATGCAGCAAGCATTTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065701    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009399.2-1394s1c1
Sequence:CCGGGTCCCTGAAATGTGGACCATTCTCGAGAATGGTCCACATTTCAGGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000362741    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009399.3-1624s21c1
Sequence:CCGGGTGACATCATCGTGGTGTATGCTCGAGCATACACCACGATGATGTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000362673    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009399.3-713s21c1
Sequence:CCGGTGCCATCATCTTCGGCGTTTACTCGAGTAAACGCCGAAGATGATGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000362740    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009399.3-132s21c1
Sequence:CCGGTGCACCCAGGAGAGGCATTATCTCGAGATAATGCCTCTCCTGGGTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009399
TNFRSF11A MISSION shRNA shRNA Plasmid DNA
tumor necrosis factor receptor superfamily, member 11a, NFKB activator
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000065698    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009399.2-790s1c1
Sequence:CCGGGCAGTAGTCTAAGTGGAAATACTCGAGTATTTCCACTTAGACTACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065699    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009399.2-1163s1c1
Sequence:CCGGCGACAGTTTAAGCCAGTGTTTCTCGAGAAACACTGGCTTAAACTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065700    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009399.2-1106s1c1
Sequence:CCGGCCAGCAGGGAAGCAAATCTATCTCGAGATAGATTTGCTTCCCTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065702    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009399.2-279s1c1
Sequence:CCGGGATAAATGCTTGCTGCATAAACTCGAGTTTATGCAGCAAGCATTTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065701    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009399.2-1394s1c1
Sequence:CCGGGTCCCTGAAATGTGGACCATTCTCGAGAATGGTCCACATTTCAGGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000362741    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009399.3-1624s21c1
Sequence:CCGGGTGACATCATCGTGGTGTATGCTCGAGCATACACCACGATGATGTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000362673    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009399.3-713s21c1
Sequence:CCGGTGCCATCATCTTCGGCGTTTACTCGAGTAAACGCCGAAGATGATGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000362740    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009399.3-132s21c1
Sequence:CCGGTGCACCCAGGAGAGGCATTATCTCGAGATAATGCCTCTCCTGGGTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009399
TNFRSF11A MISSION shRNA Lentiviral Transduction Particles
tumor necrosis factor receptor superfamily, member 11a, NFKB activator
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000065698    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009399.2-790s1c1
Sequence:CCGGGCAGTAGTCTAAGTGGAAATACTCGAGTATTTCCACTTAGACTACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065699    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009399.2-1163s1c1
Sequence:CCGGCGACAGTTTAAGCCAGTGTTTCTCGAGAAACACTGGCTTAAACTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065700    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009399.2-1106s1c1
Sequence:CCGGCCAGCAGGGAAGCAAATCTATCTCGAGATAGATTTGCTTCCCTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065702    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009399.2-279s1c1
Sequence:CCGGGATAAATGCTTGCTGCATAAACTCGAGTTTATGCAGCAAGCATTTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065701    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009399.2-1394s1c1
Sequence:CCGGGTCCCTGAAATGTGGACCATTCTCGAGAATGGTCCACATTTCAGGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000362741    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009399.3-1624s21c1
Sequence:CCGGGTGACATCATCGTGGTGTATGCTCGAGCATACACCACGATGATGTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000362673    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009399.3-713s21c1
Sequence:CCGGTGCCATCATCTTCGGCGTTTACTCGAGTAAACGCCGAAGATGATGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000362740    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009399.3-132s21c1
Sequence:CCGGTGCACCCAGGAGAGGCATTATCTCGAGATAATGCCTCTCCTGGGTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks