EMAIL THIS PAGE TO A FRIEND

TNFRSF11B

tumor necrosis factor receptor superfamily, member 11b

Synonyms: OCIF OPG TR1
UniProtKB ID: O00300, B2R9A8, O60236, Q53FX6, Q9UHP4
Gene ID:
Human(4982) Summary: The protein encoded by this gene is a member of the TNF-receptor superfamily. This protein is an osteoblast-secreted decoy receptor that functions as a negative regulator of bone resorption. This protein specifically binds to its ligand, osteoprotegerin ligand, both of which are key extracellular regulators of osteoclast development. Studies of the mouse counterpart also suggest that this protein and its ligand play a role in lymph-node organogenesis and vascular calcification. Alternatively spliced transcript variants of this gene have been reported, but their full length nature has not been determined. [provided by RefSeq, Jul 2008]
Mouse(18383) tumor necrosis factor receptor superfamily, member 11b (osteoprotegerin)
Rat(25341) tumor necrosis factor receptor superfamily, member 11b
Zebrafish(407674) tumor necrosis factor receptor superfamily, member 11b
dog(482025) tumor necrosis factor receptor superfamily, member 11b
Horse(100065885) tumor necrosis factor receptor superfamily, member 11b
domestic cat(101096878) tumor necrosis factor receptor superfamily, member 11b
chicken(378803) tumor necrosis factor receptor superfamily, member 11b
domestic guinea pig(100715850) tumor necrosis factor receptor superfamily, member 11b
Domestic Rabbit(100348133) tumor necrosis factor receptor superfamily, member 11b
naked mole-rat(101709512) tumor necrosis factor receptor superfamily, member 11b
cow(523822) tumor necrosis factor receptor superfamily, member 11b
Goat(100860896) tumor necrosis factor receptor superfamily, member 11b
128 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002546 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002546 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002546 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008764 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008764 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008764 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU005241 MISSION® esiRNA esiRNA targeting human TNFRSF11B (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002546 Rosetta Predictions human pricing
NM_012870 Rosetta Predictions rat pricing
NM_008764 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002546 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00085233 predicted 664
2 SASI_Hs01_00085234 predicted 1078
3 SASI_Hs01_00085235 predicted 1341
4 SASI_Hs01_00085236 predicted 396
5 SASI_Hs01_00085237 predicted 1135
6 SASI_Hs01_00085239 predicted 879
7 SASI_Hs01_00085240 predicted 1267
8 SASI_Hs01_00085241 predicted 810
9 SASI_Hs01_00085242 predicted 478
10 SASI_Hs02_00334035 predicted 836
11 SASI_Hs01_00085238 predicted 328
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012870 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00260361 predicted 1235
2 SASI_Rn02_00260362 predicted 295
3 SASI_Rn02_00260363 predicted 1285
4 SASI_Rn02_00260364 predicted 917
5 SASI_Rn02_00260365 predicted 614
6 SASI_Rn02_00260366 predicted 747
7 SASI_Rn02_00260367 predicted 761
8 SASI_Rn02_00260368 predicted 623
9 SASI_Rn02_00260369 predicted 1230
10 SASI_Rn02_00260370 predicted 659
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008764 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00081430 predicted 1214
2 SASI_Mm01_00081431 predicted 564
3 SASI_Mm01_00081432 predicted 757
4 SASI_Mm01_00081437 predicted 310
5 SASI_Mm01_00081439 predicted 302
6 SASI_Mm02_00314652 predicted 819
7 SASI_Mm02_00314653 predicted 673
8 SASI_Mm02_00314654 predicted 1039
9 SASI_Mm02_00314655 predicted 1159
10 SASI_Mm02_00314656 predicted 1117
11 SASI_Mm01_00081433 predicted 749
12 SASI_Mm01_00081434 predicted 1506
13 SASI_Mm01_00081435 predicted 1057
14 SASI_Mm01_00081436 predicted 319
15 SASI_Mm01_00081438 predicted 1501
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002546
VALIDATED
TNFRSF11B MISSION shRNA Bacterial Glycerol Stock
tumor necrosis factor receptor superfamily, member 11b
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000370067    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002546.3-1626s21c1
Sequence:CCGGCTCATTACCAGTGACTAATTTCTCGAGAAATTAGTCACTGGTAATGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000370026    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002546.3-774s21c1
Sequence:CCGGTCAAATGAGACGTCATCTAAACTCGAGTTTAGATGACGTCTCATTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000308034    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002546.3-1741s21c1
Sequence:CCGGTCGTTATCTACTGACTATATTCTCGAGAATATAGTCAGTAGATAACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000298918    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002546.3-1307s21c1
Sequence:CCGGGCTCAGTTTGTGGCGAATAAACTCGAGTTTATTCGCCACAAACTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000296001    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002546.3-856s21c1
Sequence:CCGGATGCAACACACGACAACATATCTCGAGATATGTTGTCGTGTGTTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000308036    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002546.3-1493s21c1
Sequence:CCGGTAACCAGGTCCAATCAGTAAACTCGAGTTTACTGATTGGACCTGGTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000331187    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002546.3-980s21c1
Sequence:CCGGGCTTAGTGTCTTGGTAGACAACTCGAGTTGTCTACCAAGACACTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038739    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002546.2-324s1c1
Sequence:CCGGCCTCCAAAGTACCTTCATTATCTCGAGATAATGAAGGTACTTTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038741    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002546.2-1301s1c1
Sequence:CCGGGCACTCAAAGACGTACCACTTCTCGAGAAGTGGTACGTCTTTGAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038740    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_002546.2-1235s1c1
Sequence:CCGGGCTCAGTTTGTGGCGAATAAACTCGAGTTTATTCGCCACAAACTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002546
VALIDATED
TNFRSF11B MISSION shRNA shRNA Plasmid DNA
tumor necrosis factor receptor superfamily, member 11b
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000370067    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002546.3-1626s21c1
Sequence:CCGGCTCATTACCAGTGACTAATTTCTCGAGAAATTAGTCACTGGTAATGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000370026    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002546.3-774s21c1
Sequence:CCGGTCAAATGAGACGTCATCTAAACTCGAGTTTAGATGACGTCTCATTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000308034    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002546.3-1741s21c1
Sequence:CCGGTCGTTATCTACTGACTATATTCTCGAGAATATAGTCAGTAGATAACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000298918    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002546.3-1307s21c1
Sequence:CCGGGCTCAGTTTGTGGCGAATAAACTCGAGTTTATTCGCCACAAACTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000296001    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002546.3-856s21c1
Sequence:CCGGATGCAACACACGACAACATATCTCGAGATATGTTGTCGTGTGTTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000308036    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002546.3-1493s21c1
Sequence:CCGGTAACCAGGTCCAATCAGTAAACTCGAGTTTACTGATTGGACCTGGTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000331187    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002546.3-980s21c1
Sequence:CCGGGCTTAGTGTCTTGGTAGACAACTCGAGTTGTCTACCAAGACACTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038739    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002546.2-324s1c1
Sequence:CCGGCCTCCAAAGTACCTTCATTATCTCGAGATAATGAAGGTACTTTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038741    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002546.2-1301s1c1
Sequence:CCGGGCACTCAAAGACGTACCACTTCTCGAGAAGTGGTACGTCTTTGAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038740    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_002546.2-1235s1c1
Sequence:CCGGGCTCAGTTTGTGGCGAATAAACTCGAGTTTATTCGCCACAAACTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002546
VALIDATED
TNFRSF11B MISSION shRNA Lentiviral Transduction Particles
tumor necrosis factor receptor superfamily, member 11b
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000370067    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002546.3-1626s21c1
Sequence:CCGGCTCATTACCAGTGACTAATTTCTCGAGAAATTAGTCACTGGTAATGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000370026    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002546.3-774s21c1
Sequence:CCGGTCAAATGAGACGTCATCTAAACTCGAGTTTAGATGACGTCTCATTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000308034    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002546.3-1741s21c1
Sequence:CCGGTCGTTATCTACTGACTATATTCTCGAGAATATAGTCAGTAGATAACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000298918    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002546.3-1307s21c1
Sequence:CCGGGCTCAGTTTGTGGCGAATAAACTCGAGTTTATTCGCCACAAACTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000296001    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002546.3-856s21c1
Sequence:CCGGATGCAACACACGACAACATATCTCGAGATATGTTGTCGTGTGTTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000308036    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002546.3-1493s21c1
Sequence:CCGGTAACCAGGTCCAATCAGTAAACTCGAGTTTACTGATTGGACCTGGTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000331187    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002546.3-980s21c1
Sequence:CCGGGCTTAGTGTCTTGGTAGACAACTCGAGTTGTCTACCAAGACACTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038739    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002546.2-324s1c1
Sequence:CCGGCCTCCAAAGTACCTTCATTATCTCGAGATAATGAAGGTACTTTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038741    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002546.2-1301s1c1
Sequence:CCGGGCACTCAAAGACGTACCACTTCTCGAGAAGTGGTACGTCTTTGAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038740    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_002546.2-1235s1c1
Sequence:CCGGGCTCAGTTTGTGGCGAATAAACTCGAGTTTATTCGCCACAAACTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008764
VALIDATED
TNFRSF11B MISSION shRNA Bacterial Glycerol Stock
tumor necrosis factor receptor superfamily, member 11b
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000065751    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008764.2-1350s1c1
Sequence:CCGGCCTGCACAGCTTCACAATGTACTCGAGTACATTGTGAAGCTGTGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065748    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008764.2-871s1c1
Sequence:CCGGCCTACCAAGATTATACCAAATCTCGAGATTTGGTATAATCTTGGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065752    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008764.2-320s1c1
Sequence:CCGGACTTGCATTATGACCCAGAAACTCGAGTTTCTGGGTCATAATGCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065749    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008764.2-1160s1c1
Sequence:CCGGGCCCAGAAGAAATTGAGAGAACTCGAGTTCTCTCAATTTCTTCTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065750    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008764.2-751s1c1
Sequence:CCGGCTGCTAATTCAGAAAGGAAATCTCGAGATTTCCTTTCTGAATTAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008764
VALIDATED
TNFRSF11B MISSION shRNA shRNA Plasmid DNA
tumor necrosis factor receptor superfamily, member 11b
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000065751    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008764.2-1350s1c1
Sequence:CCGGCCTGCACAGCTTCACAATGTACTCGAGTACATTGTGAAGCTGTGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065748    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008764.2-871s1c1
Sequence:CCGGCCTACCAAGATTATACCAAATCTCGAGATTTGGTATAATCTTGGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065752    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008764.2-320s1c1
Sequence:CCGGACTTGCATTATGACCCAGAAACTCGAGTTTCTGGGTCATAATGCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065749    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008764.2-1160s1c1
Sequence:CCGGGCCCAGAAGAAATTGAGAGAACTCGAGTTCTCTCAATTTCTTCTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065750    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008764.2-751s1c1
Sequence:CCGGCTGCTAATTCAGAAAGGAAATCTCGAGATTTCCTTTCTGAATTAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008764
VALIDATED
TNFRSF11B MISSION shRNA Lentiviral Transduction Particles
tumor necrosis factor receptor superfamily, member 11b
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000065751    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008764.2-1350s1c1
Sequence:CCGGCCTGCACAGCTTCACAATGTACTCGAGTACATTGTGAAGCTGTGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065748    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008764.2-871s1c1
Sequence:CCGGCCTACCAAGATTATACCAAATCTCGAGATTTGGTATAATCTTGGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065752    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008764.2-320s1c1
Sequence:CCGGACTTGCATTATGACCCAGAAACTCGAGTTTCTGGGTCATAATGCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065749    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008764.2-1160s1c1
Sequence:CCGGGCCCAGAAGAAATTGAGAGAACTCGAGTTCTCTCAATTTCTTCTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065750    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008764.2-751s1c1
Sequence:CCGGCTGCTAATTCAGAAAGGAAATCTCGAGATTTCCTTTCTGAATTAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks