EMAIL THIS PAGE TO A FRIEND

TNFRSF12A

tumor necrosis factor receptor superfamily, member 12A

Synonyms: CD266 FN14 TWEAKR
UniProtKB ID: Q9NP84, D3DUA6, Q9HCS0
Gene ID:
Mouse(27279) tumor necrosis factor receptor superfamily, member 12a
Rat(302965) tumor necrosis factor receptor superfamily, member 12a
cow(617439) tumor necrosis factor receptor superfamily, member 12A
sheep(101117554) tumor necrosis factor receptor superfamily, member 12A
naked mole-rat(101723688) tumor necrosis factor receptor superfamily, member 12A
domestic guinea pig(100735594) tumor necrosis factor receptor superfamily, member 12A
dog(610734) tumor necrosis factor receptor superfamily, member 12A
116 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016639 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016639 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016639 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_013749 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013749 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013749 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016639 Rosetta Predictions human pricing
NM_181086 Rosetta Predictions rat pricing
NM_013749 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016639 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00129286 predicted 334
2 SASI_Hs01_00129287 predicted 334
3 SASI_Hs01_00129289 predicted 255
4 SASI_Hs01_00129291 predicted 331
5 SASI_Hs01_00129292 predicted 269
6 SASI_Hs01_00129293 predicted 444
7 SASI_Hs02_00349803 predicted 387
8 SASI_Hs01_00129294 predicted 712
9 SASI_Hs01_00129295 predicted 821
10 SASI_Hs02_00349804 predicted 714
11 SASI_Hs01_00129288 predicted 210
12 SASI_Hs01_00129290 predicted 204
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181086 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00042222 predicted 328
2 SASI_Rn01_00042223 predicted 638
3 SASI_Rn01_00042224 predicted 262
4 SASI_Rn01_00042226 predicted 654
5 SASI_Rn01_00042227 predicted 617
6 SASI_Rn01_00042228 predicted 432
7 SASI_Rn01_00042229 predicted 437
8 SASI_Rn01_00042231 predicted 366
9 SASI_Rn02_00269667 predicted 652
10 SASI_Rn02_00269668 predicted 287
11 SASI_Rn01_00042225 predicted 573
12 SASI_Rn01_00042230 predicted 642
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013749 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00152164 predicted 537
2 SASI_Mm02_00322695 predicted 649
3 SASI_Mm01_00152165 predicted 430
4 SASI_Mm01_00152166 predicted 271
5 SASI_Mm01_00152168 predicted 325
6 SASI_Mm01_00152169 predicted 634
7 SASI_Mm01_00152170 predicted 202
8 SASI_Mm01_00152171 predicted 538
9 SASI_Mm01_00152172 predicted 361
10 SASI_Mm01_00152173 predicted 647
11 SASI_Mm01_00152167 predicted 649
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016639
VALIDATED
TNFRSF12A MISSION shRNA Bacterial Glycerol Stock
tumor necrosis factor receptor superfamily, member 12A
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000072448    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_016639.1-457s1c1
Sequence:CCGGGCCCACTCATCATTCATTCATCTCGAGATGAATGAATGATGAGTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072451    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_016639.1-353s1c1
Sequence:CCGGGCAGGAGAGAGAAGTTCACCACTCGAGTGGTGAACTTCTCTCTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000367898    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016639.2-220s21c1
Sequence:CCGGACCTGGACAAGTGCATGGACTCTCGAGAGTCCATGCACTTGTCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000360138    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016639.2-229s21c1
Sequence:CCGGAGTGCATGGACTGCGCGTCTTCTCGAGAAGACGCGCAGTCCATGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000360137    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_016639.2-402s21c1
Sequence:CCGGAGGAGAGAGAAGTTCACCACCCTCGAGGGTGGTGAACTTCTCTCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000344680    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016639.2-828s21c1
Sequence:CCGGCTCACTCAGATGTCCTGAAATCTCGAGATTTCAGGACATCTGAGTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000333035    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_016639.2-504s21c1
Sequence:CCGGGCCCACTCATCATTCATTCATCTCGAGATGAATGAATGATGAGTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000344629    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016639.2-666s21c1
Sequence:CCGGCCTCTGGCTCCAGAACAGAAACTCGAGTTTCTGTTCTGGAGCCAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000344679    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_016639.2-726s21c1
Sequence:CCGGACTAAGGAACTGCAGCATTTGCTCGAGCAAATGCTGCAGTTCCTTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000222563    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016639.1-264s1c2
Sequence:CCGGCCGGCTGCTTTGGCCCATCCTCTCGAGAGGATGGGCCAAAGCAGCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000222562    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016639.1-209s1c2
Sequence:CCGGCGCGACCGCACAGCGACTTCTCTCGAGAGAAGTCGCTGTGCGGTCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000222561    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016639.1-168s1c2
Sequence:CCGGCGCGGACCTGGACAAGTGCATCTCGAGATGCACTTGTCCAGGTCCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016639
VALIDATED
TNFRSF12A MISSION shRNA shRNA Plasmid DNA
tumor necrosis factor receptor superfamily, member 12A
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000072448    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_016639.1-457s1c1
Sequence:CCGGGCCCACTCATCATTCATTCATCTCGAGATGAATGAATGATGAGTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072451    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_016639.1-353s1c1
Sequence:CCGGGCAGGAGAGAGAAGTTCACCACTCGAGTGGTGAACTTCTCTCTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000367898    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016639.2-220s21c1
Sequence:CCGGACCTGGACAAGTGCATGGACTCTCGAGAGTCCATGCACTTGTCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000360138    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016639.2-229s21c1
Sequence:CCGGAGTGCATGGACTGCGCGTCTTCTCGAGAAGACGCGCAGTCCATGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000360137    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_016639.2-402s21c1
Sequence:CCGGAGGAGAGAGAAGTTCACCACCCTCGAGGGTGGTGAACTTCTCTCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000344680    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016639.2-828s21c1
Sequence:CCGGCTCACTCAGATGTCCTGAAATCTCGAGATTTCAGGACATCTGAGTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000333035    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_016639.2-504s21c1
Sequence:CCGGGCCCACTCATCATTCATTCATCTCGAGATGAATGAATGATGAGTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000344629    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016639.2-666s21c1
Sequence:CCGGCCTCTGGCTCCAGAACAGAAACTCGAGTTTCTGTTCTGGAGCCAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000344679    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_016639.2-726s21c1
Sequence:CCGGACTAAGGAACTGCAGCATTTGCTCGAGCAAATGCTGCAGTTCCTTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000222563    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016639.1-264s1c2
Sequence:CCGGCCGGCTGCTTTGGCCCATCCTCTCGAGAGGATGGGCCAAAGCAGCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000222562    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016639.1-209s1c2
Sequence:CCGGCGCGACCGCACAGCGACTTCTCTCGAGAGAAGTCGCTGTGCGGTCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000222561    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016639.1-168s1c2
Sequence:CCGGCGCGGACCTGGACAAGTGCATCTCGAGATGCACTTGTCCAGGTCCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016639
VALIDATED
TNFRSF12A MISSION shRNA Lentiviral Transduction Particles
tumor necrosis factor receptor superfamily, member 12A
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000072448    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_016639.1-457s1c1
Sequence:CCGGGCCCACTCATCATTCATTCATCTCGAGATGAATGAATGATGAGTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072451    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_016639.1-353s1c1
Sequence:CCGGGCAGGAGAGAGAAGTTCACCACTCGAGTGGTGAACTTCTCTCTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000367898    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016639.2-220s21c1
Sequence:CCGGACCTGGACAAGTGCATGGACTCTCGAGAGTCCATGCACTTGTCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000360138    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016639.2-229s21c1
Sequence:CCGGAGTGCATGGACTGCGCGTCTTCTCGAGAAGACGCGCAGTCCATGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000360137    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_016639.2-402s21c1
Sequence:CCGGAGGAGAGAGAAGTTCACCACCCTCGAGGGTGGTGAACTTCTCTCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000344680    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016639.2-828s21c1
Sequence:CCGGCTCACTCAGATGTCCTGAAATCTCGAGATTTCAGGACATCTGAGTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000333035    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_016639.2-504s21c1
Sequence:CCGGGCCCACTCATCATTCATTCATCTCGAGATGAATGAATGATGAGTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000344629    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016639.2-666s21c1
Sequence:CCGGCCTCTGGCTCCAGAACAGAAACTCGAGTTTCTGTTCTGGAGCCAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000344679    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_016639.2-726s21c1
Sequence:CCGGACTAAGGAACTGCAGCATTTGCTCGAGCAAATGCTGCAGTTCCTTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000222563    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016639.1-264s1c2
Sequence:CCGGCCGGCTGCTTTGGCCCATCCTCTCGAGAGGATGGGCCAAAGCAGCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000222562    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016639.1-209s1c2
Sequence:CCGGCGCGACCGCACAGCGACTTCTCTCGAGAGAAGTCGCTGTGCGGTCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000222561    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016639.1-168s1c2
Sequence:CCGGCGCGGACCTGGACAAGTGCATCTCGAGATGCACTTGTCCAGGTCCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013749
VALIDATED
TNFRSF12A MISSION shRNA Bacterial Glycerol Stock
tumor necrosis factor receptor superfamily, member 12A
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000066884    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013749.1-60s1c1
Sequence:CCGGCCTCGTGTTGGGATTCGGCTTCTCGAGAAGCCGAATCCCAACACGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066886    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013749.1-246s1c1
Sequence:CCGGCTTCAGGCTACTGTGGCCCATCTCGAGATGGGCCACAGTAGCCTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066887    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013749.1-52s1c1
Sequence:CCGGCCGCAGATCCTCGTGTTGGGACTCGAGTCCCAACACGAGGATCTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066885    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013749.1-361s1c1
Sequence:CCGGCCCATAGAGGAGACTGGTGGACTCGAGTCCACCAGTCTCCTCTATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066883    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013749.1-303s1c1
Sequence:CCGGGCTGGTTTCTAGTTTCCTGGTCTCGAGACCAGGAAACTAGAAACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000306495    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013749.1-633s21c1
Sequence:CCGGCACAAAGCGACCCATACTAAGCTCGAGCTTAGTATGGGTCGCTTTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000326919    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013749.1-303s21c1
Sequence:CCGGGCTGGTTTCTAGTTTCCTGGTCTCGAGACCAGGAAACTAGAAACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000326918    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013749.1-60s21c1
Sequence:CCGGCCTCGTGTTGGGATTCGGCTTCTCGAGAAGCCGAATCCCAACACGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000326917    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013749.1-361s21c1
Sequence:CCGGCCCATAGAGGAGACTGGTGGACTCGAGTCCACCAGTCTCCTCTATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000340916    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013749.2-443s21c1
Sequence:CCGGTCGTCGTCCATTCATTCATTCCTCGAGGAATGAATGAATGGACGACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013749
VALIDATED
TNFRSF12A MISSION shRNA shRNA Plasmid DNA
tumor necrosis factor receptor superfamily, member 12A
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000066884    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013749.1-60s1c1
Sequence:CCGGCCTCGTGTTGGGATTCGGCTTCTCGAGAAGCCGAATCCCAACACGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066886    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013749.1-246s1c1
Sequence:CCGGCTTCAGGCTACTGTGGCCCATCTCGAGATGGGCCACAGTAGCCTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066887    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013749.1-52s1c1
Sequence:CCGGCCGCAGATCCTCGTGTTGGGACTCGAGTCCCAACACGAGGATCTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066885    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013749.1-361s1c1
Sequence:CCGGCCCATAGAGGAGACTGGTGGACTCGAGTCCACCAGTCTCCTCTATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066883    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013749.1-303s1c1
Sequence:CCGGGCTGGTTTCTAGTTTCCTGGTCTCGAGACCAGGAAACTAGAAACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000306495    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013749.1-633s21c1
Sequence:CCGGCACAAAGCGACCCATACTAAGCTCGAGCTTAGTATGGGTCGCTTTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000326919    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013749.1-303s21c1
Sequence:CCGGGCTGGTTTCTAGTTTCCTGGTCTCGAGACCAGGAAACTAGAAACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000326918    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013749.1-60s21c1
Sequence:CCGGCCTCGTGTTGGGATTCGGCTTCTCGAGAAGCCGAATCCCAACACGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000326917    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013749.1-361s21c1
Sequence:CCGGCCCATAGAGGAGACTGGTGGACTCGAGTCCACCAGTCTCCTCTATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000340916    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013749.2-443s21c1
Sequence:CCGGTCGTCGTCCATTCATTCATTCCTCGAGGAATGAATGAATGGACGACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013749
VALIDATED
TNFRSF12A MISSION shRNA Lentiviral Transduction Particles
tumor necrosis factor receptor superfamily, member 12A
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000066884    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013749.1-60s1c1
Sequence:CCGGCCTCGTGTTGGGATTCGGCTTCTCGAGAAGCCGAATCCCAACACGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066886    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013749.1-246s1c1
Sequence:CCGGCTTCAGGCTACTGTGGCCCATCTCGAGATGGGCCACAGTAGCCTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066887    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013749.1-52s1c1
Sequence:CCGGCCGCAGATCCTCGTGTTGGGACTCGAGTCCCAACACGAGGATCTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066885    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013749.1-361s1c1
Sequence:CCGGCCCATAGAGGAGACTGGTGGACTCGAGTCCACCAGTCTCCTCTATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066883    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013749.1-303s1c1
Sequence:CCGGGCTGGTTTCTAGTTTCCTGGTCTCGAGACCAGGAAACTAGAAACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000306495    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013749.1-633s21c1
Sequence:CCGGCACAAAGCGACCCATACTAAGCTCGAGCTTAGTATGGGTCGCTTTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000326919    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013749.1-303s21c1
Sequence:CCGGGCTGGTTTCTAGTTTCCTGGTCTCGAGACCAGGAAACTAGAAACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000326918    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013749.1-60s21c1
Sequence:CCGGCCTCGTGTTGGGATTCGGCTTCTCGAGAAGCCGAATCCCAACACGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000326917    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013749.1-361s21c1
Sequence:CCGGCCCATAGAGGAGACTGGTGGACTCGAGTCCACCAGTCTCCTCTATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000340916    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013749.2-443s21c1
Sequence:CCGGTCGTCGTCCATTCATTCATTCCTCGAGGAATGAATGAATGGACGACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks