EMAIL THIS PAGE TO A FRIEND

TNFRSF13B

tumor necrosis factor receptor superfamily, member 13B

Synonyms: CD267 CVID CVID2 RYZN TACI TNFRSF14B
UniProtKB ID: O14836, B2R8B0, Q32LX4, Q7Z6F5
Gene ID:
Human(23495) Summary: The protein encoded by this gene is a lymphocyte-specific member of the tumor necrosis factor (TNF) receptor superfamily. It interacts with calcium-modulator and cyclophilin ligand (CAML). The protein induces activation of the transcription factors NFAT, AP1, and NF-kappa-B and plays a crucial role in humoral immunity by interacting with a TNF ligand. This gene is located within the Smith-Magenis syndrome region on chromosome 17. [provided by RefSeq, Jul 2008]
Mouse(57916) tumor necrosis factor receptor superfamily, member 13b
Rat(691719) tumor necrosis factor receptor superfamily, member 13B
chicken(770275) tumor necrosis factor receptor superfamily, member 13B
dog(609580) tumor necrosis factor receptor superfamily, member 13B
domestic cat(101089305) tumor necrosis factor receptor superfamily, member 13B
domestic guinea pig(100726640) tumor necrosis factor receptor superfamily, member 13B
naked mole-rat(101708533) tumor necrosis factor receptor superfamily, member 13B
cow(617948) tumor necrosis factor receptor superfamily, member 13B
sheep(101122200) tumor necrosis factor receptor superfamily, member 13B
50 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_021349 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_021349 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_021349 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_012452 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_012452 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_012452 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU120411 MISSION® esiRNA esiRNA human TNFRSF13B (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_012452 Rosetta Predictions human pricing
XM_001079369 Rosetta Predictions rat pricing
NM_021349 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012452 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00031748 predicted 369
2 SASI_Hs01_00031749 predicted 430
3 SASI_Hs01_00031750 predicted 297
4 SASI_Hs01_00031751 predicted 360
5 SASI_Hs01_00031753 predicted 399
6 SASI_Hs01_00031754 predicted 637
7 SASI_Hs01_00031755 predicted 222
8 SASI_Hs01_00031756 predicted 628
9 SASI_Hs01_00031757 predicted 437
10 SASI_Hs02_00344360 predicted 224
11 SASI_Hs01_00031752 predicted 350
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001079369 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00364164 predicted 384
2 SASI_Rn02_00364165 predicted 379
3 SASI_Rn02_00364166 predicted 322
4 SASI_Rn02_00364167 predicted 367
5 SASI_Rn02_00364168 predicted 392
6 SASI_Rn02_00364169 predicted 264
7 SASI_Rn02_00364170 predicted 326
8 SASI_Rn02_00364171 predicted 545
9 SASI_Rn02_00364172 predicted 301
10 SASI_Rn02_00364173 predicted 358
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021349 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00048333 predicted 325
2 SASI_Mm01_00048334 predicted 341
3 SASI_Mm01_00048335 predicted 363
4 SASI_Mm01_00048336 predicted 349
5 SASI_Mm02_00325930 predicted 200
6 SASI_Mm01_00048337 predicted 350
7 SASI_Mm01_00048338 predicted 344
8 SASI_Mm01_00048339 predicted 350
9 SASI_Mm01_00048340 predicted 232
10 SASI_Mm01_00048341 predicted 365
11 SASI_Mm01_00048342 predicted 566
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021349
TNFRSF13B MISSION shRNA Bacterial Glycerol Stock
tumor necrosis factor receptor superfamily, member 13B
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000362662    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021349.1-404s21c1
Sequence:CCGGGCGCCATCTTCTGCTGTTTCTCTCGAGAGAAACAGCAGAAGATGGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000362663    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021349.1-107s21c1
Sequence:CCGGACTTCTGCAAATTCATCAATTCTCGAGAATTGATGAATTTGCAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066926    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021349.1-113s1c1
Sequence:CCGGGCAAATTCATCAATTGCCGAACTCGAGTTCGGCAATTGATGAATTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066923    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021349.1-214s1c1
Sequence:CCGGTGTGCCCACTTCTGTGAGAAACTCGAGTTTCTCACAGAAGTGGGCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066925    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021349.1-341s1c1
Sequence:CCGGGTCCAGGATTGAGGCTAAGTACTCGAGTACTTAGCCTCAATCCTGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066924    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021349.1-567s1c1
Sequence:CCGGGCCTGTGGAAACGTGTAGCTTCTCGAGAAGCTACACGTTTCCACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066927    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021349.1-97s1c1
Sequence:CCGGACCTGTACAGACTTCTGCAAACTCGAGTTTGCAGAAGTCTGTACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021349
TNFRSF13B MISSION shRNA shRNA Plasmid DNA
tumor necrosis factor receptor superfamily, member 13B
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000362662    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021349.1-404s21c1
Sequence:CCGGGCGCCATCTTCTGCTGTTTCTCTCGAGAGAAACAGCAGAAGATGGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000362663    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021349.1-107s21c1
Sequence:CCGGACTTCTGCAAATTCATCAATTCTCGAGAATTGATGAATTTGCAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066926    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021349.1-113s1c1
Sequence:CCGGGCAAATTCATCAATTGCCGAACTCGAGTTCGGCAATTGATGAATTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066923    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021349.1-214s1c1
Sequence:CCGGTGTGCCCACTTCTGTGAGAAACTCGAGTTTCTCACAGAAGTGGGCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066925    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021349.1-341s1c1
Sequence:CCGGGTCCAGGATTGAGGCTAAGTACTCGAGTACTTAGCCTCAATCCTGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066924    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021349.1-567s1c1
Sequence:CCGGGCCTGTGGAAACGTGTAGCTTCTCGAGAAGCTACACGTTTCCACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066927    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021349.1-97s1c1
Sequence:CCGGACCTGTACAGACTTCTGCAAACTCGAGTTTGCAGAAGTCTGTACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021349
TNFRSF13B MISSION shRNA Lentiviral Transduction Particles
tumor necrosis factor receptor superfamily, member 13B
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000362662    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021349.1-404s21c1
Sequence:CCGGGCGCCATCTTCTGCTGTTTCTCTCGAGAGAAACAGCAGAAGATGGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000362663    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021349.1-107s21c1
Sequence:CCGGACTTCTGCAAATTCATCAATTCTCGAGAATTGATGAATTTGCAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066926    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021349.1-113s1c1
Sequence:CCGGGCAAATTCATCAATTGCCGAACTCGAGTTCGGCAATTGATGAATTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066923    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021349.1-214s1c1
Sequence:CCGGTGTGCCCACTTCTGTGAGAAACTCGAGTTTCTCACAGAAGTGGGCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066925    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021349.1-341s1c1
Sequence:CCGGGTCCAGGATTGAGGCTAAGTACTCGAGTACTTAGCCTCAATCCTGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066924    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021349.1-567s1c1
Sequence:CCGGGCCTGTGGAAACGTGTAGCTTCTCGAGAAGCTACACGTTTCCACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066927    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021349.1-97s1c1
Sequence:CCGGACCTGTACAGACTTCTGCAAACTCGAGTTTGCAGAAGTCTGTACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012452
TNFRSF13B MISSION shRNA Bacterial Glycerol Stock
tumor necrosis factor receptor superfamily, member 13B
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000358841    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012452.2-838s21c1
Sequence:CCGGAGACAGTGGCCTTGGCATTGTCTCGAGACAATGCCAAGGCCACTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232672    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012452.2-231s21c1
Sequence:CCGGAGGAGCAAGGCAAGTTCTATGCTCGAGCATAGAACTTGCCTTGCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232674    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012452.2-375s21c1
Sequence:CCGGAGCGGAGTGGAGAAGTTGAAACTCGAGTTTCAACTTCTCCACTCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232676    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012452.2-1011s21c1
Sequence:CCGGGGAGAGAAACAGAGGAGACAGCTCGAGCTGTCTCCTCTGTTTCTCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232675    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012452.2-469s21c1
Sequence:CCGGGCTGAAGCTGAGTGCAGATCACTCGAGTGATCTGCACTCAGCTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232673    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012452.2-299s21c1
Sequence:CCGGCACCCTAAGCAATGTGCATACCTCGAGGTATGCACATTGCTTAGGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000358842    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012452.2-1185s21c1
Sequence:CCGGGGGACAGAGAGAGATAGAGCACTCGAGTGCTCTATCTCTCTCTGTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000358910    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012452.2-618s21c1
Sequence:CCGGGTCAAAGTCCGGCCAAGTCTTCTCGAGAAGACTTGGCCGGACTTTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058963    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012452.2-301s1c1
Sequence:CCGGCCCTAAGCAATGTGCATACTTCTCGAGAAGTATGCACATTGCTTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058964    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012452.2-236s1c1
Sequence:CCGGCAAGGCAAGTTCTATGACCATCTCGAGATGGTCATAGAACTTGCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058966    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012452.2-615s1c1
Sequence:CCGGCCCGTCAAAGTCCGGCCAAGTCTCGAGACTTGGCCGGACTTTGACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058967    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012452.2-396s1c1
Sequence:CCGGACAATTCAGACAACTCGGGAACTCGAGTTCCCGAGTTGTCTGAATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058965    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012452.2-313s1c1
Sequence:CCGGTGCATACTTCTGTGAGAACAACTCGAGTTGTTCTCACAGAAGTATGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012452
TNFRSF13B MISSION shRNA shRNA Plasmid DNA
tumor necrosis factor receptor superfamily, member 13B
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000358841    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012452.2-838s21c1
Sequence:CCGGAGACAGTGGCCTTGGCATTGTCTCGAGACAATGCCAAGGCCACTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232672    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012452.2-231s21c1
Sequence:CCGGAGGAGCAAGGCAAGTTCTATGCTCGAGCATAGAACTTGCCTTGCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232674    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012452.2-375s21c1
Sequence:CCGGAGCGGAGTGGAGAAGTTGAAACTCGAGTTTCAACTTCTCCACTCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232676    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012452.2-1011s21c1
Sequence:CCGGGGAGAGAAACAGAGGAGACAGCTCGAGCTGTCTCCTCTGTTTCTCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232675    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012452.2-469s21c1
Sequence:CCGGGCTGAAGCTGAGTGCAGATCACTCGAGTGATCTGCACTCAGCTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232673    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012452.2-299s21c1
Sequence:CCGGCACCCTAAGCAATGTGCATACCTCGAGGTATGCACATTGCTTAGGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000358842    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012452.2-1185s21c1
Sequence:CCGGGGGACAGAGAGAGATAGAGCACTCGAGTGCTCTATCTCTCTCTGTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000358910    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012452.2-618s21c1
Sequence:CCGGGTCAAAGTCCGGCCAAGTCTTCTCGAGAAGACTTGGCCGGACTTTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058963    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012452.2-301s1c1
Sequence:CCGGCCCTAAGCAATGTGCATACTTCTCGAGAAGTATGCACATTGCTTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058964    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012452.2-236s1c1
Sequence:CCGGCAAGGCAAGTTCTATGACCATCTCGAGATGGTCATAGAACTTGCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058966    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012452.2-615s1c1
Sequence:CCGGCCCGTCAAAGTCCGGCCAAGTCTCGAGACTTGGCCGGACTTTGACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058967    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012452.2-396s1c1
Sequence:CCGGACAATTCAGACAACTCGGGAACTCGAGTTCCCGAGTTGTCTGAATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058965    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012452.2-313s1c1
Sequence:CCGGTGCATACTTCTGTGAGAACAACTCGAGTTGTTCTCACAGAAGTATGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012452
TNFRSF13B MISSION shRNA Lentiviral Transduction Particles
tumor necrosis factor receptor superfamily, member 13B
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000358841    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012452.2-838s21c1
Sequence:CCGGAGACAGTGGCCTTGGCATTGTCTCGAGACAATGCCAAGGCCACTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232672    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012452.2-231s21c1
Sequence:CCGGAGGAGCAAGGCAAGTTCTATGCTCGAGCATAGAACTTGCCTTGCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232674    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012452.2-375s21c1
Sequence:CCGGAGCGGAGTGGAGAAGTTGAAACTCGAGTTTCAACTTCTCCACTCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232676    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012452.2-1011s21c1
Sequence:CCGGGGAGAGAAACAGAGGAGACAGCTCGAGCTGTCTCCTCTGTTTCTCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232675    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012452.2-469s21c1
Sequence:CCGGGCTGAAGCTGAGTGCAGATCACTCGAGTGATCTGCACTCAGCTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232673    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012452.2-299s21c1
Sequence:CCGGCACCCTAAGCAATGTGCATACCTCGAGGTATGCACATTGCTTAGGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000358842    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012452.2-1185s21c1
Sequence:CCGGGGGACAGAGAGAGATAGAGCACTCGAGTGCTCTATCTCTCTCTGTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000358910    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012452.2-618s21c1
Sequence:CCGGGTCAAAGTCCGGCCAAGTCTTCTCGAGAAGACTTGGCCGGACTTTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058963    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012452.2-301s1c1
Sequence:CCGGCCCTAAGCAATGTGCATACTTCTCGAGAAGTATGCACATTGCTTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058964    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012452.2-236s1c1
Sequence:CCGGCAAGGCAAGTTCTATGACCATCTCGAGATGGTCATAGAACTTGCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058966    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012452.2-615s1c1
Sequence:CCGGCCCGTCAAAGTCCGGCCAAGTCTCGAGACTTGGCCGGACTTTGACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058967    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012452.2-396s1c1
Sequence:CCGGACAATTCAGACAACTCGGGAACTCGAGTTCCCGAGTTGTCTGAATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058965    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012452.2-313s1c1
Sequence:CCGGTGCATACTTCTGTGAGAACAACTCGAGTTGTTCTCACAGAAGTATGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks