EMAIL THIS PAGE TO A FRIEND

TNFRSF13C

tumor necrosis factor receptor superfamily, member 13C

Synonyms: BAFF-R BAFFR BROMIX CD268 CVID4 prolixin
UniProtKB ID: Q96RJ3
Gene ID:
Human(115650) Summary: B cell-activating factor (BAFF) enhances B-cell survival in vitro and is a regulator of the peripheral B-cell population. Overexpression of Baff in mice results in mature B-cell hyperplasia and symptoms of systemic lupus erythematosus (SLE). Also, some SLE patients have increased levels of BAFF in serum. Therefore, it has been proposed that abnormally high levels of BAFF may contribute to the pathogenesis of autoimmune diseases by enhancing the survival of autoreactive B cells. The protein encoded by this gene is a receptor for BAFF and is a type III transmembrane protein containing a single extracellular cysteine-rich domain. It is thought that this receptor is the principal receptor required for BAFF-mediated mature B-cell survival. [provided by RefSeq, Jul 2008]
Mouse(72049) tumor necrosis factor receptor superfamily, member 13c
Rat(500910) tumor necrosis factor receptor superfamily, member 13c
sheep(101104901) tumor necrosis factor receptor superfamily, member 13C
naked mole-rat(101700523) tumor necrosis factor receptor superfamily, member 13C
domestic guinea pig(100713376) tumor necrosis factor receptor superfamily, member 13C
chicken(417983) tumor necrosis factor receptor superfamily, member 13C
domestic cat(101090370) tumor necrosis factor receptor superfamily, member 13C
dog(607785) tumor necrosis factor receptor superfamily, member 13C
Horse(100070724) tumor necrosis factor receptor superfamily, member 13C
80 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

ELISA

Product # Description Species Add to Cart
 
RAB0758 Mouse Tnfrsf13C ELISA Kit mouse pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_052945 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_052945 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_052945 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_028075 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028075 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028075 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU005211 MISSION® esiRNA esiRNA targeting mouse Tnfrsf13c (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_052945 Rosetta Predictions human pricing
XM_001077542 Rosetta Predictions rat pricing
XM_576316 Rosetta Predictions rat pricing
NM_028075 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_052945 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00058971 predicted 649
2 SASI_Hs01_00058972 predicted 578
3 SASI_Hs01_00058973 predicted 675
4 SASI_Hs01_00058974 predicted 549
5 SASI_Hs01_00058975 predicted 445
6 SASI_Hs01_00058976 predicted 577
7 SASI_Hs01_00058977 predicted 574
8 SASI_Hs02_00361733 predicted 706
9 SASI_Hs01_00058980 predicted 547
10 SASI_Hs02_00361734 predicted 576
11 SASI_Hs01_00058978 predicted 650
12 SASI_Hs01_00058979 predicted 509
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001077542 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00357484 predicted 399
2 SASI_Rn02_00357485 predicted 396
3 SASI_Rn02_00357486 predicted 338
4 SASI_Rn02_00357487 predicted 426
5 SASI_Rn02_00357488 predicted 193
6 SASI_Rn02_00357489 predicted 253
7 SASI_Rn02_00357490 predicted 318
8 SASI_Rn02_00357491 predicted 339
9 SASI_Rn02_00357492 predicted 468
10 SASI_Rn02_00357493 predicted 193
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_576316 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00405049 predicted 308
2 SASI_Rn02_00405050 predicted 398
3 SASI_Rn02_00405051 predicted 395
4 SASI_Rn02_00405052 predicted 342
5 SASI_Rn02_00405053 predicted 430
6 SASI_Rn02_00405054 predicted 384
7 SASI_Rn02_00405055 predicted 196
8 SASI_Rn02_00405056 predicted 245
9 SASI_Rn02_00405057 predicted 319
10 SASI_Rn02_00405058 predicted 336
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028075 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00029040 predicted 674
2 SASI_Mm02_00333291 predicted 776
3 SASI_Mm01_00029042 predicted 613
4 SASI_Mm02_00333292 predicted 597
5 SASI_Mm01_00029043 predicted 787
6 SASI_Mm02_00333293 predicted 672
7 SASI_Mm01_00029044 predicted 710
8 SASI_Mm01_00029046 predicted 710
9 SASI_Mm01_00029047 predicted 663
10 SASI_Mm01_00029049 predicted 417
11 SASI_Mm01_00029041 predicted 633
12 SASI_Mm01_00029045 predicted 577
13 SASI_Mm01_00029048 predicted 759
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_052945
TNFRSF13C MISSION shRNA Bacterial Glycerol Stock
tumor necrosis factor receptor superfamily, member 13C
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000058889    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052945.2-511s1c1
Sequence:CCGGGCTCCACTGAACTGGTGACCACTCGAGTGGTCACCAGTTCAGTGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058890    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052945.2-69s1c1
Sequence:CCGGGCCGAGTGCTTCGACCTGCTGCTCGAGCAGCAGGTCGAAGCACTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058892    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052945.2-517s1c1
Sequence:CCGGCTGAACTGGTGACCACCAAGACTCGAGTCTTGGTGGTCACCAGTTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058888    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052945.2-395s1c1
Sequence:CCGGCATCATTCTGTCTCCGGGAATCTCGAGATTCCCGGAGACAGAATGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058891    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052945.2-382s1c1
Sequence:CCGGCCCTGGACAAGGTCATCATTCCTCGAGGAATGATGACCTTGTCCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000367918    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_052945.3-683s21c1
Sequence:CCGGAGCATGCACATGCCCTCTTTCCTCGAGGAAAGAGGGCATGTGCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000367919    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052945.3-557s21c1
Sequence:CCGGTGAACTGGTGACCACCAAGACCTCGAGGTCTTGGTGGTCACCAGTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_052945
TNFRSF13C MISSION shRNA shRNA Plasmid DNA
tumor necrosis factor receptor superfamily, member 13C
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000058889    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052945.2-511s1c1
Sequence:CCGGGCTCCACTGAACTGGTGACCACTCGAGTGGTCACCAGTTCAGTGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058890    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052945.2-69s1c1
Sequence:CCGGGCCGAGTGCTTCGACCTGCTGCTCGAGCAGCAGGTCGAAGCACTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058892    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052945.2-517s1c1
Sequence:CCGGCTGAACTGGTGACCACCAAGACTCGAGTCTTGGTGGTCACCAGTTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058888    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052945.2-395s1c1
Sequence:CCGGCATCATTCTGTCTCCGGGAATCTCGAGATTCCCGGAGACAGAATGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058891    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052945.2-382s1c1
Sequence:CCGGCCCTGGACAAGGTCATCATTCCTCGAGGAATGATGACCTTGTCCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000367918    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_052945.3-683s21c1
Sequence:CCGGAGCATGCACATGCCCTCTTTCCTCGAGGAAAGAGGGCATGTGCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000367919    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052945.3-557s21c1
Sequence:CCGGTGAACTGGTGACCACCAAGACCTCGAGGTCTTGGTGGTCACCAGTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_052945
TNFRSF13C MISSION shRNA Lentiviral Transduction Particles
tumor necrosis factor receptor superfamily, member 13C
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000058889    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052945.2-511s1c1
Sequence:CCGGGCTCCACTGAACTGGTGACCACTCGAGTGGTCACCAGTTCAGTGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058890    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052945.2-69s1c1
Sequence:CCGGGCCGAGTGCTTCGACCTGCTGCTCGAGCAGCAGGTCGAAGCACTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058892    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052945.2-517s1c1
Sequence:CCGGCTGAACTGGTGACCACCAAGACTCGAGTCTTGGTGGTCACCAGTTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058888    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052945.2-395s1c1
Sequence:CCGGCATCATTCTGTCTCCGGGAATCTCGAGATTCCCGGAGACAGAATGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058891    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052945.2-382s1c1
Sequence:CCGGCCCTGGACAAGGTCATCATTCCTCGAGGAATGATGACCTTGTCCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000367918    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_052945.3-683s21c1
Sequence:CCGGAGCATGCACATGCCCTCTTTCCTCGAGGAAAGAGGGCATGTGCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000367919    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052945.3-557s21c1
Sequence:CCGGTGAACTGGTGACCACCAAGACCTCGAGGTCTTGGTGGTCACCAGTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028075
TNFRSF13C MISSION shRNA Bacterial Glycerol Stock
tumor necrosis factor receptor superfamily, member 13C
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000066733    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028075.1-152s1c1
Sequence:CCGGCGCCGGACACTGGACATACAACTCGAGTTGTATGTCCAGTGTCCGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066736    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028075.1-388s1c1
Sequence:CCGGGTCTTTGTACCCTCCTCAGAACTCGAGTTCTGAGGAGGGTACAAAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066737    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028075.1-261s1c1
Sequence:CCGGCCTGGGACTGATACTGGCGCTCTCGAGAGCGCCAGTATCAGTCCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066734    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028075.1-440s1c1
Sequence:CCGGCGCTCAAAGAAGATGCAGACACTCGAGTGTCTGCATCTTCTTTGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066735    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028075.1-83s1c1
Sequence:CCGGCCCAGTGCAATCAGACCGAGTCTCGAGACTCGGTCTGATTGCACTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000362686    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028075.2-389s21c1
Sequence:CCGGTCTTTGTACCCTCCTCAGAAACTCGAGTTTCTGAGGAGGGTACAAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000362751    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028075.2-717s21c1
Sequence:CCGGTGACTTGAGAACGTTCCATTTCTCGAGAAATGGAACGTTCTCAAGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000362749    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028075.2-106s21c1
Sequence:CCGGTTCGACCCTCTGGTGAGAAACCTCGAGGTTTCTCACCAGAGGGTCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000362800    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028075.2-780s21c1
Sequence:CCGGAGACTTGAGGGTTGCATATTTCTCGAGAAATATGCAACCCTCAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028075
TNFRSF13C MISSION shRNA shRNA Plasmid DNA
tumor necrosis factor receptor superfamily, member 13C
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000066733    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028075.1-152s1c1
Sequence:CCGGCGCCGGACACTGGACATACAACTCGAGTTGTATGTCCAGTGTCCGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066736    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028075.1-388s1c1
Sequence:CCGGGTCTTTGTACCCTCCTCAGAACTCGAGTTCTGAGGAGGGTACAAAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066737    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028075.1-261s1c1
Sequence:CCGGCCTGGGACTGATACTGGCGCTCTCGAGAGCGCCAGTATCAGTCCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066734    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028075.1-440s1c1
Sequence:CCGGCGCTCAAAGAAGATGCAGACACTCGAGTGTCTGCATCTTCTTTGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066735    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028075.1-83s1c1
Sequence:CCGGCCCAGTGCAATCAGACCGAGTCTCGAGACTCGGTCTGATTGCACTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000362686    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028075.2-389s21c1
Sequence:CCGGTCTTTGTACCCTCCTCAGAAACTCGAGTTTCTGAGGAGGGTACAAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000362751    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028075.2-717s21c1
Sequence:CCGGTGACTTGAGAACGTTCCATTTCTCGAGAAATGGAACGTTCTCAAGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000362749    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028075.2-106s21c1
Sequence:CCGGTTCGACCCTCTGGTGAGAAACCTCGAGGTTTCTCACCAGAGGGTCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000362800    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028075.2-780s21c1
Sequence:CCGGAGACTTGAGGGTTGCATATTTCTCGAGAAATATGCAACCCTCAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028075
TNFRSF13C MISSION shRNA Lentiviral Transduction Particles
tumor necrosis factor receptor superfamily, member 13C
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000066733    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028075.1-152s1c1
Sequence:CCGGCGCCGGACACTGGACATACAACTCGAGTTGTATGTCCAGTGTCCGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066736    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028075.1-388s1c1
Sequence:CCGGGTCTTTGTACCCTCCTCAGAACTCGAGTTCTGAGGAGGGTACAAAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066737    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028075.1-261s1c1
Sequence:CCGGCCTGGGACTGATACTGGCGCTCTCGAGAGCGCCAGTATCAGTCCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066734    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028075.1-440s1c1
Sequence:CCGGCGCTCAAAGAAGATGCAGACACTCGAGTGTCTGCATCTTCTTTGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066735    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028075.1-83s1c1
Sequence:CCGGCCCAGTGCAATCAGACCGAGTCTCGAGACTCGGTCTGATTGCACTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000362686    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028075.2-389s21c1
Sequence:CCGGTCTTTGTACCCTCCTCAGAAACTCGAGTTTCTGAGGAGGGTACAAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000362751    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028075.2-717s21c1
Sequence:CCGGTGACTTGAGAACGTTCCATTTCTCGAGAAATGGAACGTTCTCAAGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000362749    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028075.2-106s21c1
Sequence:CCGGTTCGACCCTCTGGTGAGAAACCTCGAGGTTTCTCACCAGAGGGTCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000362800    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028075.2-780s21c1
Sequence:CCGGAGACTTGAGGGTTGCATATTTCTCGAGAAATATGCAACCCTCAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks