EMAIL THIS PAGE TO A FRIEND

TNFRSF14

tumor necrosis factor receptor superfamily, member 14

Synonyms: ATAR CD270 HVEA HVEM LIGHTR TR2
UniProtKB ID: Q92956, B9DI89, Q6IB95, Q8WXR1, Q96J31, Q9UM65
Gene ID:
Human(8764) Summary: The protein encoded by this gene is a member of the TNF-receptor superfamily. This receptor was identified as a cellular mediator of herpes simplex virus (HSV) entry. Binding of HSV viral envelope glycoprotein D (gD) to this receptor protein has been shown to be part of the viral entry mechanism. The cytoplasmic region of this receptor was found to bind to several TRAF family members, which may mediate the signal transduction pathways that activate the immune response. [provided by RefSeq, Jul 2008]
Mouse(230979) tumor necrosis factor receptor superfamily, member 14 (herpesvirus entry mediator)
Rat(366518) tumor necrosis factor receptor superfamily, member 14
chicken(420403) tumor necrosis factor receptor superfamily, member 14
dog(479580) tumor necrosis factor receptor superfamily, member 14
Horse(100034069) tumor necrosis factor receptor superfamily, member 14
domestic cat(101089877) tumor necrosis factor receptor superfamily, member 14
domestic guinea pig(100733551) tumor necrosis factor receptor superfamily, member 14
64 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

ELISA

Product # Description Species Add to Cart
 
RAB0485 Human HVEM ELISA Kit for serum, plasma and cell culture supernatant human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003820 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003820 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003820 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_178931 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_178931 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_178931 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU080621 MISSION® esiRNA esiRNA human TNFRSF14 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003820 Rosetta Predictions human pricing
NM_001015034 Rosetta Predictions rat pricing
NM_178931 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003820 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00185463 predicted 762
2 SASI_Hs01_00185464 predicted 1327
3 SASI_Hs01_00185465 predicted 955
4 SASI_Hs01_00185466 predicted 924
5 SASI_Hs02_00336366 predicted 955
6 SASI_Hs01_00185467 predicted 946
7 SASI_Hs01_00185468 predicted 1108
8 SASI_Hs01_00185469 predicted 458
9 SASI_Hs02_00336367 predicted 956
10 SASI_Hs01_00185471 predicted 661
11 SASI_Hs01_00185462 predicted 1039
12 SASI_Hs01_00185470 predicted 991
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001015034 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00202170 predicted 636
2 SASI_Rn02_00202171 predicted 322
3 SASI_Rn02_00202172 predicted 537
4 SASI_Rn02_00202173 predicted 1157
5 SASI_Rn02_00202174 predicted 693
6 SASI_Rn02_00202175 predicted 580
7 SASI_Rn02_00202176 predicted 713
8 SASI_Rn02_00202177 predicted 716
9 SASI_Rn02_00202178 predicted 1048
10 SASI_Rn02_00202179 predicted 1201
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178931 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00186435 predicted 266
2 SASI_Mm01_00186436 predicted 497
3 SASI_Mm01_00186438 predicted 585
4 SASI_Mm02_00349565 predicted 207
5 SASI_Mm02_00349566 predicted 270
6 SASI_Mm01_00186439 predicted 373
7 SASI_Mm01_00186440 predicted 279
8 SASI_Mm01_00186442 predicted 386
9 SASI_Mm01_00186443 predicted 579
10 SASI_Mm02_00349567 predicted 560
11 SASI_Mm01_00186437 predicted 540
12 SASI_Mm01_00186441 predicted 208
13 SASI_Mm01_00186444 predicted 228
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003820
TNFRSF14 MISSION shRNA Bacterial Glycerol Stock
tumor necrosis factor receptor superfamily, member 14
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000419201    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003820.2-833s21c1
Sequence:CCGGATGTCAGCACCAGACCAAGTGCTCGAGCACTTGGTCTGGTGCTGACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416770    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003820.2-992s21c1
Sequence:CCGGGGGTGATGTAGTCAAGGTGATCTCGAGATCACCTTGACTACATCACCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416111    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003820.2-894s21c1
Sequence:CCGGTCCCACTGGGTATGGTGGTTTCTCGAGAAACCACCATACCCAGTGGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059172    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003820.2-1105s1c1
Sequence:CCGGTGGAGGAGACAATACCCTCATCTCGAGATGAGGGTATTGTCTCCTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059170    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003820.2-947s1c1
Sequence:CCGGCTCCACAGTTGGCCTAATCATCTCGAGATGATTAGGCCAACTGTGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059171    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003820.2-365s1c1
Sequence:CCGGGCTGGTGCTGTATCTCACCTTCTCGAGAAGGTGAGATACAGCACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059169    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003820.2-470s1c1
Sequence:CCGGCAGTCCAGGTTATCGTGTGAACTCGAGTTCACACGATAACCTGGACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059168    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003820.2-925s1c1
Sequence:CCGGGCCTCGTCATCGTCATTGTTTCTCGAGAAACAATGACGATGACGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003820
TNFRSF14 MISSION shRNA shRNA Plasmid DNA
tumor necrosis factor receptor superfamily, member 14
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000419201    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003820.2-833s21c1
Sequence:CCGGATGTCAGCACCAGACCAAGTGCTCGAGCACTTGGTCTGGTGCTGACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416770    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003820.2-992s21c1
Sequence:CCGGGGGTGATGTAGTCAAGGTGATCTCGAGATCACCTTGACTACATCACCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416111    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003820.2-894s21c1
Sequence:CCGGTCCCACTGGGTATGGTGGTTTCTCGAGAAACCACCATACCCAGTGGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059172    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003820.2-1105s1c1
Sequence:CCGGTGGAGGAGACAATACCCTCATCTCGAGATGAGGGTATTGTCTCCTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059170    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003820.2-947s1c1
Sequence:CCGGCTCCACAGTTGGCCTAATCATCTCGAGATGATTAGGCCAACTGTGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059171    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003820.2-365s1c1
Sequence:CCGGGCTGGTGCTGTATCTCACCTTCTCGAGAAGGTGAGATACAGCACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059169    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003820.2-470s1c1
Sequence:CCGGCAGTCCAGGTTATCGTGTGAACTCGAGTTCACACGATAACCTGGACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059168    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003820.2-925s1c1
Sequence:CCGGGCCTCGTCATCGTCATTGTTTCTCGAGAAACAATGACGATGACGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003820
TNFRSF14 MISSION shRNA Lentiviral Transduction Particles
tumor necrosis factor receptor superfamily, member 14
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000419201    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003820.2-833s21c1
Sequence:CCGGATGTCAGCACCAGACCAAGTGCTCGAGCACTTGGTCTGGTGCTGACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416770    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003820.2-992s21c1
Sequence:CCGGGGGTGATGTAGTCAAGGTGATCTCGAGATCACCTTGACTACATCACCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416111    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003820.2-894s21c1
Sequence:CCGGTCCCACTGGGTATGGTGGTTTCTCGAGAAACCACCATACCCAGTGGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059172    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003820.2-1105s1c1
Sequence:CCGGTGGAGGAGACAATACCCTCATCTCGAGATGAGGGTATTGTCTCCTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059170    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003820.2-947s1c1
Sequence:CCGGCTCCACAGTTGGCCTAATCATCTCGAGATGATTAGGCCAACTGTGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059171    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003820.2-365s1c1
Sequence:CCGGGCTGGTGCTGTATCTCACCTTCTCGAGAAGGTGAGATACAGCACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059169    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003820.2-470s1c1
Sequence:CCGGCAGTCCAGGTTATCGTGTGAACTCGAGTTCACACGATAACCTGGACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059168    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003820.2-925s1c1
Sequence:CCGGGCCTCGTCATCGTCATTGTTTCTCGAGAAACAATGACGATGACGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178931
TNFRSF14 MISSION shRNA Bacterial Glycerol Stock
tumor necrosis factor receptor superfamily, member 14
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000065853    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178931.2-652s1c1
Sequence:CCGGCGTCTACTACGTTGTGTCCATCTCGAGATGGACACAACGTAGTAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065857    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178931.2-590s1c1
Sequence:CCGGGCATTTCAACAGGAAGTAAGACTCGAGTCTTACTTCCTGTTGAAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065854    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178931.2-202s1c1
Sequence:CCGGCAACCCAGGTTACCATGTGAACTCGAGTTCACATGGTAACCTGGGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065855    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178931.2-99s1c1
Sequence:CCGGTGGTGCCTTGTGTCTTCCTTTCTCGAGAAAGGAAGACACAAGGCACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065856    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178931.2-269s1c1
Sequence:CCGGCCACAGACATATACCGCCCATCTCGAGATGGGCGGTATATGTCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178931
TNFRSF14 MISSION shRNA shRNA Plasmid DNA
tumor necrosis factor receptor superfamily, member 14
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000065853    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178931.2-652s1c1
Sequence:CCGGCGTCTACTACGTTGTGTCCATCTCGAGATGGACACAACGTAGTAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065857    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178931.2-590s1c1
Sequence:CCGGGCATTTCAACAGGAAGTAAGACTCGAGTCTTACTTCCTGTTGAAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065854    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178931.2-202s1c1
Sequence:CCGGCAACCCAGGTTACCATGTGAACTCGAGTTCACATGGTAACCTGGGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065855    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178931.2-99s1c1
Sequence:CCGGTGGTGCCTTGTGTCTTCCTTTCTCGAGAAAGGAAGACACAAGGCACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065856    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178931.2-269s1c1
Sequence:CCGGCCACAGACATATACCGCCCATCTCGAGATGGGCGGTATATGTCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178931
TNFRSF14 MISSION shRNA Lentiviral Transduction Particles
tumor necrosis factor receptor superfamily, member 14
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000065853    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178931.2-652s1c1
Sequence:CCGGCGTCTACTACGTTGTGTCCATCTCGAGATGGACACAACGTAGTAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065857    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178931.2-590s1c1
Sequence:CCGGGCATTTCAACAGGAAGTAAGACTCGAGTCTTACTTCCTGTTGAAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065854    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178931.2-202s1c1
Sequence:CCGGCAACCCAGGTTACCATGTGAACTCGAGTTCACATGGTAACCTGGGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065855    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178931.2-99s1c1
Sequence:CCGGTGGTGCCTTGTGTCTTCCTTTCTCGAGAAAGGAAGACACAAGGCACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065856    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178931.2-269s1c1
Sequence:CCGGCCACAGACATATACCGCCCATCTCGAGATGGGCGGTATATGTCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks