EMAIL THIS PAGE TO A FRIEND

TNFRSF17

tumor necrosis factor receptor superfamily, member 17

Synonyms: BCM BCMA CD269 TNFRSF13A
UniProtKB ID: Q02223
Gene ID:
Human(608) Summary: The protein encoded by this gene is a member of the TNF-receptor superfamily. This receptor is preferentially expressed in mature B lymphocytes, and may be important for B cell development and autoimmune response. This receptor has been shown to specifically bind to the tumor necrosis factor (ligand) superfamily, member 13b (TNFSF13B/TALL-1/BAFF), and to lead to NF-kappaB and MAPK8/JNK activation. This receptor also binds to various TRAF family members, and thus may transduce signals for cell survival and proliferation. [provided by RefSeq, Jul 2008]
Mouse(21935) tumor necrosis factor receptor superfamily, member 17
Rat(287034) tumor necrosis factor receptor superfamily, member 17
cow(784268) tumor necrosis factor receptor superfamily, member 17
sheep(101111149) tumor necrosis factor receptor superfamily, member 17
domestic guinea pig(100727998) tumor necrosis factor receptor superfamily, member 17
naked mole-rat(101720701) tumor necrosis factor receptor superfamily, member 17
domestic cat(101086618) tumor necrosis factor receptor superfamily, member 17
69 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

ELISA

Product # Description Species Add to Cart
 
RAB0745 Human TNFRSF17 ELISA Kit human pricing
RAB0760 Mouse Tnfrsf17 ELISA Kit mouse pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001192 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001192 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001192 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011608 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011608 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011608 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU022961 MISSION® esiRNA esiRNA human TNFRSF17 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001192 Rosetta Predictions human pricing
NM_001105761 Rosetta Predictions rat pricing
NM_011608 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001192 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00229758 predicted 358
2 SASI_Hs01_00229759 predicted 655
3 SASI_Hs01_00229760 predicted 465
4 SASI_Hs01_00229761 predicted 383
5 SASI_Hs01_00229762 predicted 607
6 SASI_Hs01_00229763 predicted 388
7 SASI_Hs01_00229764 predicted 638
8 SASI_Hs01_00229765 predicted 633
9 SASI_Hs01_00229766 predicted 633
10 SASI_Hs02_00331332 predicted 567
11 SASI_Hs01_00229767 predicted 596
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105761 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00212266 predicted 312
2 SASI_Rn02_00212267 predicted 483
3 SASI_Rn02_00212268 predicted 512
4 SASI_Rn02_00212269 predicted 251
5 SASI_Rn02_00212270 predicted 421
6 SASI_Rn02_00212271 predicted 408
7 SASI_Rn02_00212272 predicted 348
8 SASI_Rn02_00212273 predicted 286
9 SASI_Rn02_00212274 predicted 209
10 SASI_Rn02_00212275 predicted 489
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011608 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00033098 predicted 221
2 SASI_Mm01_00033099 predicted 260
3 SASI_Mm01_00033100 predicted 505
4 SASI_Mm01_00033101 predicted 195
5 SASI_Mm01_00033102 predicted 338
6 SASI_Mm01_00033103 predicted 252
7 SASI_Mm01_00033104 predicted 372
8 SASI_Mm01_00033105 predicted 279
9 SASI_Mm01_00033106 predicted 457
10 SASI_Mm01_00033107 predicted 278
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001192
TNFRSF17 MISSION shRNA Bacterial Glycerol Stock
tumor necrosis factor receptor superfamily, member 17
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000058588    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001192.2-465s1c1
Sequence:CCGGGAACCATTAAAGGACGAGTTTCTCGAGAAACTCGTCCTTTAATGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058589    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001192.2-280s1c1
Sequence:CCGGGCATACCTTGTCAACTTCGATCTCGAGATCGAAGTTGACAAGGTATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058592    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001192.2-630s1c1
Sequence:CCGGGTCGACTCTGACCATTGCTTTCTCGAGAAAGCAATGGTCAGAGTCGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058591    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001192.2-739s1c1
Sequence:CCGGCTACGGAGATAGAGAAATCAACTCGAGTTGATTTCTCTATCTCCGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058590    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001192.2-332s1c1
Sequence:CCGGGCGTTATTGTAATGCAAGTGTCTCGAGACACTTGCATTACAATAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000363246    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001192.2-455s21c1
Sequence:CCGGGATAAACTCTGAACCATTAAACTCGAGTTTAATGGTTCAGAGTTTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000359591    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001192.2-319s21c1
Sequence:CCGGCTCTAACATGTCAGCGTTATTCTCGAGAATAACGCTGACATGTTAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000363259    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001192.2-394s21c1
Sequence:CCGGGTTTGGGACTGAGCTTAATAACTCGAGTTATTAAGCTCAGTCCCAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001192
TNFRSF17 MISSION shRNA shRNA Plasmid DNA
tumor necrosis factor receptor superfamily, member 17
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000058588    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001192.2-465s1c1
Sequence:CCGGGAACCATTAAAGGACGAGTTTCTCGAGAAACTCGTCCTTTAATGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058589    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001192.2-280s1c1
Sequence:CCGGGCATACCTTGTCAACTTCGATCTCGAGATCGAAGTTGACAAGGTATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058592    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001192.2-630s1c1
Sequence:CCGGGTCGACTCTGACCATTGCTTTCTCGAGAAAGCAATGGTCAGAGTCGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058591    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001192.2-739s1c1
Sequence:CCGGCTACGGAGATAGAGAAATCAACTCGAGTTGATTTCTCTATCTCCGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058590    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001192.2-332s1c1
Sequence:CCGGGCGTTATTGTAATGCAAGTGTCTCGAGACACTTGCATTACAATAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000363246    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001192.2-455s21c1
Sequence:CCGGGATAAACTCTGAACCATTAAACTCGAGTTTAATGGTTCAGAGTTTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000359591    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001192.2-319s21c1
Sequence:CCGGCTCTAACATGTCAGCGTTATTCTCGAGAATAACGCTGACATGTTAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000363259    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001192.2-394s21c1
Sequence:CCGGGTTTGGGACTGAGCTTAATAACTCGAGTTATTAAGCTCAGTCCCAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001192
TNFRSF17 MISSION shRNA Lentiviral Transduction Particles
tumor necrosis factor receptor superfamily, member 17
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000058588    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001192.2-465s1c1
Sequence:CCGGGAACCATTAAAGGACGAGTTTCTCGAGAAACTCGTCCTTTAATGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058589    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001192.2-280s1c1
Sequence:CCGGGCATACCTTGTCAACTTCGATCTCGAGATCGAAGTTGACAAGGTATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058592    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001192.2-630s1c1
Sequence:CCGGGTCGACTCTGACCATTGCTTTCTCGAGAAAGCAATGGTCAGAGTCGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058591    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001192.2-739s1c1
Sequence:CCGGCTACGGAGATAGAGAAATCAACTCGAGTTGATTTCTCTATCTCCGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058590    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001192.2-332s1c1
Sequence:CCGGGCGTTATTGTAATGCAAGTGTCTCGAGACACTTGCATTACAATAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000363246    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001192.2-455s21c1
Sequence:CCGGGATAAACTCTGAACCATTAAACTCGAGTTTAATGGTTCAGAGTTTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000359591    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001192.2-319s21c1
Sequence:CCGGCTCTAACATGTCAGCGTTATTCTCGAGAATAACGCTGACATGTTAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000363259    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001192.2-394s21c1
Sequence:CCGGGTTTGGGACTGAGCTTAATAACTCGAGTTATTAAGCTCAGTCCCAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011608
TNFRSF17 MISSION shRNA Bacterial Glycerol Stock
tumor necrosis factor receptor superfamily, member 17
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000065898    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011608.1-526s1c1
Sequence:CCGGGAGGACTGTGTCAAGAGCAAACTCGAGTTTGCTCTTGACACAGTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065899    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011608.1-623s1c1
Sequence:CCGGCGGGTGACTACGGCAAGTCAACTCGAGTTGACTTGCCGTAGTCACCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065900    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011608.1-466s1c1
Sequence:CCGGGCTGGTGACGACAGGATCTTTCTCGAGAAAGATCCTGTCGTCACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065902    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011608.1-269s1c1
Sequence:CCGGGTTCAGTGAAAGGGACGTACACTCGAGTGTACGTCCCTTTCACTGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065901    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011608.1-197s1c1
Sequence:CCGGGCAAACCGTGTCACTTGCGATCTCGAGATCGCAAGTGACACGGTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000362550    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011608.1-313s21c1
Sequence:CCGGCTGACCTTGGTCCTCTCTTTGCTCGAGCAAAGAGAGGACCAAGGTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000362547    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011608.1-260s21c1
Sequence:CCGGGCGTGACCAGTTCAGTGAAAGCTCGAGCTTTCACTGAACTGGTCACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000362613    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011608.1-467s21c1
Sequence:CCGGCTGGTGACGACAGGATCTTTCCTCGAGGAAAGATCCTGTCGTCACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000362612    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011608.1-201s21c1
Sequence:CCGGACCGTGTCACTTGCGATGTTCCTCGAGGAACATCGCAAGTGACACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011608
TNFRSF17 MISSION shRNA shRNA Plasmid DNA
tumor necrosis factor receptor superfamily, member 17
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000065898    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011608.1-526s1c1
Sequence:CCGGGAGGACTGTGTCAAGAGCAAACTCGAGTTTGCTCTTGACACAGTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065899    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011608.1-623s1c1
Sequence:CCGGCGGGTGACTACGGCAAGTCAACTCGAGTTGACTTGCCGTAGTCACCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065900    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011608.1-466s1c1
Sequence:CCGGGCTGGTGACGACAGGATCTTTCTCGAGAAAGATCCTGTCGTCACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065902    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011608.1-269s1c1
Sequence:CCGGGTTCAGTGAAAGGGACGTACACTCGAGTGTACGTCCCTTTCACTGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065901    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011608.1-197s1c1
Sequence:CCGGGCAAACCGTGTCACTTGCGATCTCGAGATCGCAAGTGACACGGTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000362550    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011608.1-313s21c1
Sequence:CCGGCTGACCTTGGTCCTCTCTTTGCTCGAGCAAAGAGAGGACCAAGGTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000362547    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011608.1-260s21c1
Sequence:CCGGGCGTGACCAGTTCAGTGAAAGCTCGAGCTTTCACTGAACTGGTCACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000362613    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011608.1-467s21c1
Sequence:CCGGCTGGTGACGACAGGATCTTTCCTCGAGGAAAGATCCTGTCGTCACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000362612    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011608.1-201s21c1
Sequence:CCGGACCGTGTCACTTGCGATGTTCCTCGAGGAACATCGCAAGTGACACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011608
TNFRSF17 MISSION shRNA Lentiviral Transduction Particles
tumor necrosis factor receptor superfamily, member 17
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000065898    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011608.1-526s1c1
Sequence:CCGGGAGGACTGTGTCAAGAGCAAACTCGAGTTTGCTCTTGACACAGTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065899    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011608.1-623s1c1
Sequence:CCGGCGGGTGACTACGGCAAGTCAACTCGAGTTGACTTGCCGTAGTCACCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065900    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011608.1-466s1c1
Sequence:CCGGGCTGGTGACGACAGGATCTTTCTCGAGAAAGATCCTGTCGTCACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065902    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011608.1-269s1c1
Sequence:CCGGGTTCAGTGAAAGGGACGTACACTCGAGTGTACGTCCCTTTCACTGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065901    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011608.1-197s1c1
Sequence:CCGGGCAAACCGTGTCACTTGCGATCTCGAGATCGCAAGTGACACGGTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000362550    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011608.1-313s21c1
Sequence:CCGGCTGACCTTGGTCCTCTCTTTGCTCGAGCAAAGAGAGGACCAAGGTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000362547    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011608.1-260s21c1
Sequence:CCGGGCGTGACCAGTTCAGTGAAAGCTCGAGCTTTCACTGAACTGGTCACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000362613    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011608.1-467s21c1
Sequence:CCGGCTGGTGACGACAGGATCTTTCCTCGAGGAAAGATCCTGTCGTCACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000362612    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011608.1-201s21c1
Sequence:CCGGACCGTGTCACTTGCGATGTTCCTCGAGGAACATCGCAAGTGACACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks