EMAIL THIS PAGE TO A FRIEND

TNFRSF18

tumor necrosis factor receptor superfamily, member 18

Synonyms: AITR CD357 GITR GITR-D
UniProtKB ID: Q9Y5U5, B1AME1, O95851, Q5U0I4, Q9NYJ9
Gene ID:
Human(8784) Summary: This gene encodes a member of the TNF-receptor superfamily. The encoded receptor has been shown to have increased expression upon T-cell activation, and it is thought to play a key role in dominant immunological self-tolerance maintained by CD25(+)CD4(+) regulatory T cells. Knockout studies in mice also suggest the role of this receptor is in the regulation of CD3-driven T-cell activation and programmed cell death. Three alternatively spliced transcript variants of this gene encoding distinct isoforms have been reported. [provided by RefSeq, Feb 2011]
Mouse(21936) tumor necrosis factor receptor superfamily, member 18
Rat(500598) tumor necrosis factor receptor superfamily, member 18
Zebrafish(571217) tumor necrosis factor receptor superfamily, member 18
domestic cat(101083251) tumor necrosis factor receptor superfamily, member 18
dog(606971) tumor necrosis factor receptor superfamily, member 18
chicken(419424) tumor necrosis factor receptor superfamily, member 18
naked mole-rat(101715065) tumor necrosis factor receptor superfamily, member 18
domestic guinea pig(100715459) tumor necrosis factor receptor superfamily, member 18
cow(516256) tumor necrosis factor receptor superfamily, member 18
sheep(101108672) tumor necrosis factor receptor superfamily, member 18
86 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004195 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004195 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004195 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009400 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009400 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009400 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004195 Rosetta Predictions human pricing
NM_148901 Rosetta Predictions human pricing
NM_148902 Rosetta Predictions human pricing
NM_001024349 Rosetta Predictions rat pricing
NM_009400 Rosetta Predictions mouse pricing
NM_021985 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004195 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00126945 predicted 277
2 SASI_Hs01_00126946 predicted 312
3 SASI_Hs01_00126947 predicted 268
4 SASI_Hs01_00126948 predicted 276
5 SASI_Hs01_00126949 predicted 276
6 SASI_Hs01_00126950 predicted 243
7 SASI_Hs01_00126951 predicted 293
8 SASI_Hs01_00126952 predicted 274
9 SASI_Hs01_00126953 predicted 280
10 SASI_Hs01_00126954 predicted 243
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_148901 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00015635 predicted 272
2 SASI_Hs01_00015636 predicted 305
3 SASI_Hs01_00015637 predicted 266
4 SASI_Hs01_00015638 predicted 270
5 SASI_Hs01_00015639 predicted 278
6 SASI_Hs01_00015640 predicted 246
7 SASI_Hs01_00015641 predicted 301
8 SASI_Hs01_00015642 predicted 272
9 SASI_Hs01_00015643 predicted 289
10 SASI_Hs01_00015644 predicted 250
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_148902 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00161859 predicted 275
2 SASI_Hs01_00161860 predicted 312
3 SASI_Hs01_00161861 predicted 267
4 SASI_Hs01_00161862 predicted 270
5 SASI_Hs01_00161863 predicted 276
6 SASI_Hs01_00161864 predicted 246
7 SASI_Hs01_00161865 predicted 296
8 SASI_Hs01_00161866 predicted 277
9 SASI_Hs01_00161867 predicted 282
10 SASI_Hs01_00161868 predicted 244
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024349 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00057327 predicted 528
2 SASI_Rn01_00057328 predicted 668
3 SASI_Rn01_00057329 predicted 312
4 SASI_Rn01_00057330 predicted 245
5 SASI_Rn01_00057331 predicted 569
6 SASI_Rn01_00057332 predicted 582
7 SASI_Rn01_00057333 predicted 673
8 SASI_Rn01_00057334 predicted 322
9 SASI_Rn01_00057335 predicted 472
10 SASI_Rn01_00057336 predicted 699
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009400 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00077748 predicted 405
2 SASI_Mm01_00077749 predicted 486
3 SASI_Mm01_00077750 predicted 361
4 SASI_Mm01_00077751 predicted 491
5 SASI_Mm01_00077752 predicted 514
6 SASI_Mm01_00077753 predicted 393
7 SASI_Mm01_00077754 predicted 255
8 SASI_Mm01_00077755 predicted 399
9 SASI_Mm01_00077756 predicted 239
10 SASI_Mm01_00077757 predicted 558
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021985 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00059040 predicted 356
2 SASI_Mm01_00059041 predicted 218
3 SASI_Mm01_00059042 predicted 259
4 SASI_Mm01_00059043 predicted 239
5 SASI_Mm01_00059044 predicted 420
6 SASI_Mm01_00059045 predicted 574
7 SASI_Mm01_00059046 predicted 559
8 SASI_Mm01_00059048 predicted 571
9 SASI_Mm01_00059049 predicted 410
10 SASI_Mm02_00326466 predicted 230
11 SASI_Mm01_00059047 predicted 390
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004195
TNFRSF18 MISSION shRNA Bacterial Glycerol Stock
tumor necrosis factor receptor superfamily, member 18
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000373785    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004195.2-519s21c1
Sequence:CCGGCTGCAAACCTTGGACAGACTGCTCGAGCAGTCTGTCCAAGGTTTGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000373705    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004195.2-575s21c1
Sequence:CCGGACAAGACCCACAACGCTGTGTCTCGAGACACAGCGTTGTGGGTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000373787    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004195.2-464s21c1
Sequence:CCGGGCTTCCAGTGTATCGACTGTGCTCGAGCACAGTCGATACACTGGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000373786    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004195.2-686s21c1
Sequence:CCGGCCCAGCTTGGACTGCACATCTCTCGAGAGATGTGCAGTCCAAGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058373    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004195.2-353s1c1
Sequence:CCGGGCATGTGTGTCCAGCCTGAATCTCGAGATTCAGGCTGGACACACATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058374    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004195.2-251s1c1
Sequence:CCGGGCCTCCTGCTTGGGACGGGAACTCGAGTTCCCGTCCCAAGCAGGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058376    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004195.2-770s1c1
Sequence:CCGGCGACCGAAGACGCCAGAAGCTCTCGAGAGCTTCTGGCGTCTTCGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058377    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004195.2-336s1c1
Sequence:CCGGCTGTTCCGAGTGGGACTGCATCTCGAGATGCAGTCCCACTCGGAACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058375    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004195.2-545s1c1
Sequence:CCGGAGTTCGGGTTTCTCACTGTGTCTCGAGACACAGTGAGAAACCCGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004195
TNFRSF18 MISSION shRNA shRNA Plasmid DNA
tumor necrosis factor receptor superfamily, member 18
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000373785    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004195.2-519s21c1
Sequence:CCGGCTGCAAACCTTGGACAGACTGCTCGAGCAGTCTGTCCAAGGTTTGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000373705    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004195.2-575s21c1
Sequence:CCGGACAAGACCCACAACGCTGTGTCTCGAGACACAGCGTTGTGGGTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000373787    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004195.2-464s21c1
Sequence:CCGGGCTTCCAGTGTATCGACTGTGCTCGAGCACAGTCGATACACTGGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000373786    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004195.2-686s21c1
Sequence:CCGGCCCAGCTTGGACTGCACATCTCTCGAGAGATGTGCAGTCCAAGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058373    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004195.2-353s1c1
Sequence:CCGGGCATGTGTGTCCAGCCTGAATCTCGAGATTCAGGCTGGACACACATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058374    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004195.2-251s1c1
Sequence:CCGGGCCTCCTGCTTGGGACGGGAACTCGAGTTCCCGTCCCAAGCAGGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058376    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004195.2-770s1c1
Sequence:CCGGCGACCGAAGACGCCAGAAGCTCTCGAGAGCTTCTGGCGTCTTCGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058377    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004195.2-336s1c1
Sequence:CCGGCTGTTCCGAGTGGGACTGCATCTCGAGATGCAGTCCCACTCGGAACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058375    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004195.2-545s1c1
Sequence:CCGGAGTTCGGGTTTCTCACTGTGTCTCGAGACACAGTGAGAAACCCGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004195
TNFRSF18 MISSION shRNA Lentiviral Transduction Particles
tumor necrosis factor receptor superfamily, member 18
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000373785    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004195.2-519s21c1
Sequence:CCGGCTGCAAACCTTGGACAGACTGCTCGAGCAGTCTGTCCAAGGTTTGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000373705    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004195.2-575s21c1
Sequence:CCGGACAAGACCCACAACGCTGTGTCTCGAGACACAGCGTTGTGGGTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000373787    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004195.2-464s21c1
Sequence:CCGGGCTTCCAGTGTATCGACTGTGCTCGAGCACAGTCGATACACTGGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000373786    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004195.2-686s21c1
Sequence:CCGGCCCAGCTTGGACTGCACATCTCTCGAGAGATGTGCAGTCCAAGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058373    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004195.2-353s1c1
Sequence:CCGGGCATGTGTGTCCAGCCTGAATCTCGAGATTCAGGCTGGACACACATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058374    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004195.2-251s1c1
Sequence:CCGGGCCTCCTGCTTGGGACGGGAACTCGAGTTCCCGTCCCAAGCAGGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058376    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004195.2-770s1c1
Sequence:CCGGCGACCGAAGACGCCAGAAGCTCTCGAGAGCTTCTGGCGTCTTCGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058377    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004195.2-336s1c1
Sequence:CCGGCTGTTCCGAGTGGGACTGCATCTCGAGATGCAGTCCCACTCGGAACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058375    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004195.2-545s1c1
Sequence:CCGGAGTTCGGGTTTCTCACTGTGTCTCGAGACACAGTGAGAAACCCGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009400
TNFRSF18 MISSION shRNA Bacterial Glycerol Stock
tumor necrosis factor receptor superfamily, member 18
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000065953    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009400.1-766s1c1
Sequence:CCGGCTACAAGACTTGCCCAGCTATCTCGAGATAGCTGGGCAAGTCTTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065957    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009400.1-486s1c1
Sequence:CCGGCACTGAGCAATACGGCCATTTCTCGAGAAATGGCCGTATTGCTCAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065954    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009400.1-498s1c1
Sequence:CCGGCGGCCATTTGACTGTCATCTTCTCGAGAAGATGACAGTCAAATGGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065955    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009400.1-392s1c1
Sequence:CCGGGCAGACTTTGGACCAACTGTTCTCGAGAACAGTTGGTCCAAAGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065956    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009400.1-404s1c1
Sequence:CCGGCCAACTGTTCTCAGTTTGGATCTCGAGATCCAAACTGAGAACAGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009400
TNFRSF18 MISSION shRNA shRNA Plasmid DNA
tumor necrosis factor receptor superfamily, member 18
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000065953    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009400.1-766s1c1
Sequence:CCGGCTACAAGACTTGCCCAGCTATCTCGAGATAGCTGGGCAAGTCTTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065957    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009400.1-486s1c1
Sequence:CCGGCACTGAGCAATACGGCCATTTCTCGAGAAATGGCCGTATTGCTCAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065954    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009400.1-498s1c1
Sequence:CCGGCGGCCATTTGACTGTCATCTTCTCGAGAAGATGACAGTCAAATGGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065955    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009400.1-392s1c1
Sequence:CCGGGCAGACTTTGGACCAACTGTTCTCGAGAACAGTTGGTCCAAAGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065956    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009400.1-404s1c1
Sequence:CCGGCCAACTGTTCTCAGTTTGGATCTCGAGATCCAAACTGAGAACAGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009400
TNFRSF18 MISSION shRNA Lentiviral Transduction Particles
tumor necrosis factor receptor superfamily, member 18
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000065953    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009400.1-766s1c1
Sequence:CCGGCTACAAGACTTGCCCAGCTATCTCGAGATAGCTGGGCAAGTCTTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065957    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009400.1-486s1c1
Sequence:CCGGCACTGAGCAATACGGCCATTTCTCGAGAAATGGCCGTATTGCTCAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065954    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009400.1-498s1c1
Sequence:CCGGCGGCCATTTGACTGTCATCTTCTCGAGAAGATGACAGTCAAATGGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065955    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009400.1-392s1c1
Sequence:CCGGGCAGACTTTGGACCAACTGTTCTCGAGAACAGTTGGTCCAAAGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065956    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009400.1-404s1c1
Sequence:CCGGCCAACTGTTCTCAGTTTGGATCTCGAGATCCAAACTGAGAACAGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks