EMAIL THIS PAGE TO A FRIEND

TNFRSF19

tumor necrosis factor receptor superfamily, member 19

Synonyms: TAJ TAJ-alpha TRADE TROY
Gene ID:
Human(55504) Summary: The protein encoded by this gene is a member of the TNF-receptor superfamily. This receptor is highly expressed during embryonic development. It has been shown to interact with TRAF family members, and to activate JNK signaling pathway when overexpressed in cells. This receptor is capable of inducing apoptosis by a caspase-independent mechanism, and it is thought to play an essential role in embryonic development. Alternatively spliced transcript variants encoding distinct isoforms have been described. [provided by RefSeq, Jul 2008]
Mouse(29820) tumor necrosis factor receptor superfamily, member 19
Rat(290300) tumor necrosis factor receptor superfamily, member 19
cow(768037) tumor necrosis factor receptor superfamily, member 19
sheep(101116664) tumor necrosis factor receptor superfamily, member 19
domestic guinea pig(100728457) tumor necrosis factor receptor superfamily, member 19
naked mole-rat(101697520) tumor necrosis factor receptor superfamily, member 19
Zebrafish(559725) tumor necrosis factor receptor superfamily, member 19
Horse(100057564) tumor necrosis factor receptor superfamily, member 19
chicken(418943) tumor necrosis factor receptor superfamily, member 19
domestic cat(101095303) tumor necrosis factor receptor superfamily, member 19
dog(486042) tumor necrosis factor receptor superfamily, member 19
146 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018647 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018647 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018647 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_013869 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013869 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013869 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018647 Rosetta Predictions human pricing
NM_148957 Rosetta Predictions human pricing
NM_001044229 Rosetta Predictions rat pricing
XM_214214 Rosetta Predictions rat pricing
NM_013869 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018647 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00147042 predicted 351
2 SASI_Hs01_00147043 predicted 1068
3 SASI_Hs01_00147044 predicted 433
4 SASI_Hs01_00147045 predicted 1006
5 SASI_Hs01_00147046 predicted 428
6 SASI_Hs01_00147047 predicted 1057
7 SASI_Hs01_00147048 predicted 723
8 SASI_Hs01_00147049 predicted 512
9 SASI_Hs01_00147050 predicted 433
10 SASI_Hs01_00147051 predicted 922
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_148957 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00063766 predicted 581
2 SASI_Hs01_00063767 predicted 1296
3 SASI_Hs01_00063768 predicted 669
4 SASI_Hs01_00063769 predicted 1236
5 SASI_Hs01_00063770 predicted 668
6 SASI_Hs01_00063771 predicted 1291
7 SASI_Hs01_00063772 predicted 957
8 SASI_Hs01_00063773 predicted 742
9 SASI_Hs01_00063774 predicted 675
10 SASI_Hs01_00063775 predicted 1152
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001044229 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00205017 predicted 288
2 SASI_Rn02_00205018 predicted 745
3 SASI_Rn02_00205019 predicted 672
4 SASI_Rn02_00205020 predicted 439
5 SASI_Rn02_00205021 predicted 572
6 SASI_Rn02_00205022 predicted 309
7 SASI_Rn02_00205023 predicted 547
8 SASI_Rn02_00205024 predicted 993
9 SASI_Rn02_00205025 predicted 642
10 SASI_Rn02_00205026 predicted 944
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_214214 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00169479 predicted 252
2 SASI_Rn01_00169480 predicted 664
3 SASI_Rn01_00169481 predicted 675
4 SASI_Rn01_00169482 predicted 636
5 SASI_Rn01_00169483 predicted 271
6 SASI_Rn01_00169484 predicted 398
7 SASI_Rn01_00169485 predicted 622
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013869 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00119874 predicted 1065
2 SASI_Mm01_00119875 predicted 1722
3 SASI_Mm01_00119876 predicted 442
4 SASI_Mm01_00119877 predicted 1123
5 SASI_Mm01_00119878 predicted 814
6 SASI_Mm01_00119879 predicted 1102
7 SASI_Mm01_00119880 predicted 1376
8 SASI_Mm02_00322885 predicted 1661
9 SASI_Mm01_00119881 predicted 489
10 SASI_Mm01_00119882 predicted 376
11 SASI_Mm01_00119873 predicted 477
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018647
TNFRSF19 MISSION shRNA Bacterial Glycerol Stock
tumor necrosis factor receptor superfamily, member 19
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000058883    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018647.2-122s1c1
Sequence:CCGGCTAGGCTATTTGTCATGTAAACTCGAGTTTACATGACAAATAGCCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058884    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018647.2-1220s1c1
Sequence:CCGGGCATCAACTCAGGATGCACTACTCGAGTAGTGCATCCTGAGTTGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058886    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018647.2-1092s1c1
Sequence:CCGGGCTCAACGTCTTTGGATTCAACTCGAGTTGAATCCAAAGACGTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058887    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018647.2-634s1c1
Sequence:CCGGCATCTATTGTAAGAGACAGTTCTCGAGAACTGTCTCTTACAATAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058885    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018647.2-228s1c1
Sequence:CCGGGCATGGAGTTGTCTAAGGAATCTCGAGATTCCTTAGACAACTCCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018647
TNFRSF19 MISSION shRNA shRNA Plasmid DNA
tumor necrosis factor receptor superfamily, member 19
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000058883    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018647.2-122s1c1
Sequence:CCGGCTAGGCTATTTGTCATGTAAACTCGAGTTTACATGACAAATAGCCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058884    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018647.2-1220s1c1
Sequence:CCGGGCATCAACTCAGGATGCACTACTCGAGTAGTGCATCCTGAGTTGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058886    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018647.2-1092s1c1
Sequence:CCGGGCTCAACGTCTTTGGATTCAACTCGAGTTGAATCCAAAGACGTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058887    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018647.2-634s1c1
Sequence:CCGGCATCTATTGTAAGAGACAGTTCTCGAGAACTGTCTCTTACAATAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058885    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018647.2-228s1c1
Sequence:CCGGGCATGGAGTTGTCTAAGGAATCTCGAGATTCCTTAGACAACTCCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018647
TNFRSF19 MISSION shRNA Lentiviral Transduction Particles
tumor necrosis factor receptor superfamily, member 19
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000058883    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018647.2-122s1c1
Sequence:CCGGCTAGGCTATTTGTCATGTAAACTCGAGTTTACATGACAAATAGCCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058884    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018647.2-1220s1c1
Sequence:CCGGGCATCAACTCAGGATGCACTACTCGAGTAGTGCATCCTGAGTTGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058886    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018647.2-1092s1c1
Sequence:CCGGGCTCAACGTCTTTGGATTCAACTCGAGTTGAATCCAAAGACGTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058887    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018647.2-634s1c1
Sequence:CCGGCATCTATTGTAAGAGACAGTTCTCGAGAACTGTCTCTTACAATAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058885    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018647.2-228s1c1
Sequence:CCGGGCATGGAGTTGTCTAAGGAATCTCGAGATTCCTTAGACAACTCCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013869
VALIDATED
TNFRSF19 MISSION shRNA Bacterial Glycerol Stock
tumor necrosis factor receptor superfamily, member 19
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000066052    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_013869.3-749s1c1
Sequence:CCGGGAAGACCAAACTGGTTGGTTTCTCGAGAAACCAACCAGTTTGGTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066048    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013869.3-450s1c1
Sequence:CCGGGCATGTAAAGTGAGTTGCGAACTCGAGTTCGCAACTCACTTTACATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066049    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013869.3-1468s1c1
Sequence:CCGGCTGGGAATGTTTCAGAATCTACTCGAGTAGATTCTGAAACATTCCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066051    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_013869.3-1259s1c1
Sequence:CCGGCGGGTCTGTTTCCCGTTCCATCTCGAGATGGAACGGGAAACAGACCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066050    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_013869.3-953s1c1
Sequence:CCGGCTACTGCAAGAGGCAGTTCATCTCGAGATGAACTGCCTCTTGCAGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000448001    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013869.5-1920s21c1
Sequence:CCGGGCTAGCTCAGGATGCTCAAAGCTCGAGCTTTGAGCATCCTGAGCTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000446673    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013869.5-2112s21c1
Sequence:CCGGTGAACCAAACTGACAACATTTCTCGAGAAATGTTGTCAGTTTGGTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013869
VALIDATED
TNFRSF19 MISSION shRNA shRNA Plasmid DNA
tumor necrosis factor receptor superfamily, member 19
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000066052    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_013869.3-749s1c1
Sequence:CCGGGAAGACCAAACTGGTTGGTTTCTCGAGAAACCAACCAGTTTGGTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066048    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013869.3-450s1c1
Sequence:CCGGGCATGTAAAGTGAGTTGCGAACTCGAGTTCGCAACTCACTTTACATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066049    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013869.3-1468s1c1
Sequence:CCGGCTGGGAATGTTTCAGAATCTACTCGAGTAGATTCTGAAACATTCCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066051    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_013869.3-1259s1c1
Sequence:CCGGCGGGTCTGTTTCCCGTTCCATCTCGAGATGGAACGGGAAACAGACCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066050    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_013869.3-953s1c1
Sequence:CCGGCTACTGCAAGAGGCAGTTCATCTCGAGATGAACTGCCTCTTGCAGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000448001    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013869.5-1920s21c1
Sequence:CCGGGCTAGCTCAGGATGCTCAAAGCTCGAGCTTTGAGCATCCTGAGCTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000446673    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013869.5-2112s21c1
Sequence:CCGGTGAACCAAACTGACAACATTTCTCGAGAAATGTTGTCAGTTTGGTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013869
VALIDATED
TNFRSF19 MISSION shRNA Lentiviral Transduction Particles
tumor necrosis factor receptor superfamily, member 19
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000066052    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_013869.3-749s1c1
Sequence:CCGGGAAGACCAAACTGGTTGGTTTCTCGAGAAACCAACCAGTTTGGTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066048    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013869.3-450s1c1
Sequence:CCGGGCATGTAAAGTGAGTTGCGAACTCGAGTTCGCAACTCACTTTACATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066049    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013869.3-1468s1c1
Sequence:CCGGCTGGGAATGTTTCAGAATCTACTCGAGTAGATTCTGAAACATTCCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066051    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_013869.3-1259s1c1
Sequence:CCGGCGGGTCTGTTTCCCGTTCCATCTCGAGATGGAACGGGAAACAGACCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066050    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_013869.3-953s1c1
Sequence:CCGGCTACTGCAAGAGGCAGTTCATCTCGAGATGAACTGCCTCTTGCAGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000448001    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013869.5-1920s21c1
Sequence:CCGGGCTAGCTCAGGATGCTCAAAGCTCGAGCTTTGAGCATCCTGAGCTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000446673    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013869.5-2112s21c1
Sequence:CCGGTGAACCAAACTGACAACATTTCTCGAGAAATGTTGTCAGTTTGGTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks