EMAIL THIS PAGE TO A FRIEND

TNFRSF1A

tumor necrosis factor receptor superfamily, member 1A

Synonyms: CD120a FPF MS5 TBP1 TNF-R TNF-R-I TNF-R55 TNFAR TNFR1 TNFR1-d2 TNFR55 TNFR60 p55 p55-R p60
Gene ID:
Human(7132) Summary: The protein encoded by this gene is a member of the TNF-receptor superfamily. This protein is one of the major receptors for the tumor necrosis factor-alpha. This receptor can activate NF-kappaB, mediate apoptosis, and function as a regulator of inflammation. Antiapoptotic protein BCL2-associated athanogene 4 (BAG4/SODD) and adaptor proteins TRADD and TRAF2 have been shown to interact with this receptor, and thus play regulatory roles in the signal transduction mediated by the receptor. Germline mutations of the extracellular domains of this receptor were found to be associated with the autosomal dominant periodic fever syndrome. The impaired receptor clearance is thought to be a mechanism of the disease. [provided by RefSeq, Jul 2008]
Mouse(21937) tumor necrosis factor receptor superfamily, member 1a
Rat(25625) tumor necrosis factor receptor superfamily, member 1a
Zebrafish(406471) tumor necrosis factor receptor superfamily, member 1a
Horse(100059548) tumor necrosis factor receptor superfamily, member 1A
domestic cat(493957) tumor necrosis factor receptor superfamily, member 1A
chicken(418325) tumor necrosis factor receptor superfamily, member 1A
dog(403634) tumor necrosis factor receptor superfamily, member 1A
naked mole-rat(101698980) tumor necrosis factor receptor superfamily, member 1A
domestic guinea pig(100713890) tumor necrosis factor receptor superfamily, member 1A
cow(282527) tumor necrosis factor receptor superfamily, member 1A
sheep(100135698) tumor necrosis factor receptor superfamily, member 1A
69 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001065 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001065 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001065 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011609 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011609 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011609 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001065 Rosetta Predictions human pricing
NM_013091 Rosetta Predictions rat pricing
NM_011609 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001065 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00033456 predicted 809
2 SASI_Hs01_00033457 predicted 608
3 SASI_Hs01_00033458 predicted 465
4 SASI_Hs01_00033459 predicted 660
5 SASI_Hs01_00033460 predicted 672
6 SASI_Hs01_00033461 predicted 615
7 SASI_Hs01_00033462 predicted 665
8 SASI_Hs01_00033463 predicted 822
9 SASI_Hs01_00033464 predicted 814
10 SASI_Hs01_00033465 predicted 474
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013091 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00038797 predicted 461
2 SASI_Rn02_00260858 predicted 743
3 SASI_Rn01_00038799 predicted 1164
4 SASI_Rn01_00038800 predicted 563
5 SASI_Rn01_00038801 predicted 731
6 SASI_Rn01_00038802 predicted 368
7 SASI_Rn01_00038804 predicted 1556
8 SASI_Rn01_00038805 predicted 480
9 SASI_Rn01_00038806 predicted 718
10 SASI_Rn02_00260859 predicted 347
11 SASI_Rn01_00038798 predicted 1458
12 SASI_Rn01_00038803 predicted 1157
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011609 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00048453 predicted 526
2 SASI_Mm01_00048455 predicted 563
3 SASI_Mm01_00048456 predicted 780
4 SASI_Mm01_00048457 predicted 1153
5 SASI_Mm01_00048458 predicted 970
6 SASI_Mm02_00321034 predicted 1026
7 SASI_Mm01_00048460 predicted 1210
8 SASI_Mm02_00321035 predicted 954
9 SASI_Mm02_00321036 predicted 391
10 SASI_Mm01_00048461 predicted 430
11 SASI_Mm01_00048454 predicted 1471
12 SASI_Mm01_00048459 predicted 947
13 SASI_Mm01_00048462 predicted 1332
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001065
TNFRSF1A MISSION shRNA Bacterial Glycerol Stock
tumor necrosis factor receptor superfamily, member 1A
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000378351    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001065.2-329s21c1
Sequence:CCGGGGAGCTGTTGGTGGGAATATACTCGAGTATATTCCCACCAACAGCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000359596    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001065.2-1056s21c1
Sequence:CCGGCTTGAAGGAACTACTACTAAGCTCGAGCTTAGTAGTAGTTCCTTCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000359597    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001065.2-957s21c1
Sequence:CCGGTCCCTCCTCTTCATTGGTTTACTCGAGTAAACCAATGAAGAGGAGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000368663    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001065.2-667s21c1
Sequence:CCGGAGAACCAGTACCGGCATTATTCTCGAGAATAATGCCGGTACTGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058713    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001065.2-968s1c1
Sequence:CCGGCATTGGTTTAATGTATCGCTACTCGAGTAGCGATACATTAAACCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058715    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001065.2-822s1c1
Sequence:CCGGTCCTGTAGTAACTGTAAGAAACTCGAGTTTCTTACAGTTACTACAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001065
TNFRSF1A MISSION shRNA shRNA Plasmid DNA
tumor necrosis factor receptor superfamily, member 1A
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000378351    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001065.2-329s21c1
Sequence:CCGGGGAGCTGTTGGTGGGAATATACTCGAGTATATTCCCACCAACAGCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000359596    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001065.2-1056s21c1
Sequence:CCGGCTTGAAGGAACTACTACTAAGCTCGAGCTTAGTAGTAGTTCCTTCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000359597    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001065.2-957s21c1
Sequence:CCGGTCCCTCCTCTTCATTGGTTTACTCGAGTAAACCAATGAAGAGGAGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000368663    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001065.2-667s21c1
Sequence:CCGGAGAACCAGTACCGGCATTATTCTCGAGAATAATGCCGGTACTGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058713    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001065.2-968s1c1
Sequence:CCGGCATTGGTTTAATGTATCGCTACTCGAGTAGCGATACATTAAACCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058715    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001065.2-822s1c1
Sequence:CCGGTCCTGTAGTAACTGTAAGAAACTCGAGTTTCTTACAGTTACTACAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001065
TNFRSF1A MISSION shRNA Lentiviral Transduction Particles
tumor necrosis factor receptor superfamily, member 1A
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000378351    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001065.2-329s21c1
Sequence:CCGGGGAGCTGTTGGTGGGAATATACTCGAGTATATTCCCACCAACAGCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000359596    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001065.2-1056s21c1
Sequence:CCGGCTTGAAGGAACTACTACTAAGCTCGAGCTTAGTAGTAGTTCCTTCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000359597    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001065.2-957s21c1
Sequence:CCGGTCCCTCCTCTTCATTGGTTTACTCGAGTAAACCAATGAAGAGGAGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000368663    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001065.2-667s21c1
Sequence:CCGGAGAACCAGTACCGGCATTATTCTCGAGAATAATGCCGGTACTGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058713    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001065.2-968s1c1
Sequence:CCGGCATTGGTTTAATGTATCGCTACTCGAGTAGCGATACATTAAACCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058715    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001065.2-822s1c1
Sequence:CCGGTCCTGTAGTAACTGTAAGAAACTCGAGTTTCTTACAGTTACTACAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011609
VALIDATED
TNFRSF1A MISSION shRNA Bacterial Glycerol Stock
tumor necrosis factor receptor superfamily, member 1A
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000348432    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011609.4-952s21c1
Sequence:CCGGGGTTATCTTGCTAGGTCTTTGCTCGAGCAAAGACCTAGCAAGATAACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000335199    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011609.4-1567s21c1
Sequence:CCGGCCTCGTGCTTTCCAAGATGAACTCGAGTTCATCTTGGAAAGCACGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000335200    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011609.4-1681s21c1
Sequence:CCGGCCTTAGGAAGAGGGACTTGAACTCGAGTTCAAGTCCCTCTTCCTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000335198    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011609.4-1025s21c1
Sequence:CCGGCCCGAAGTCTACTCCATCATTCTCGAGAATGATGGAGTAGACTTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066103    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_011609.2-1652s1c1
Sequence:CCGGCCTTAGGAAGAGGGACTTGAACTCGAGTTCAAGTCCCTCTTCCTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066107    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_011609.2-780s1c1
Sequence:CCGGGCAGGGTTCTTTCTGAGAGAACTCGAGTTCTCTCAGAAAGAACCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066104    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_011609.2-996s1c1
Sequence:CCGGCCCGAAGTCTACTCCATCATTCTCGAGAATGATGGAGTAGACTTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066105    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_011609.2-406s1c1
Sequence:CCGGCCCAAGGAAAGTATGTCCATTCTCGAGAATGGACATACTTTCCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066106    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_011609.2-1538s1c1
Sequence:CCGGCCTCGTGCTTTCCAAGATGAACTCGAGTTCATCTTGGAAAGCACGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011609
VALIDATED
TNFRSF1A MISSION shRNA shRNA Plasmid DNA
tumor necrosis factor receptor superfamily, member 1A
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000348432    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011609.4-952s21c1
Sequence:CCGGGGTTATCTTGCTAGGTCTTTGCTCGAGCAAAGACCTAGCAAGATAACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000335199    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011609.4-1567s21c1
Sequence:CCGGCCTCGTGCTTTCCAAGATGAACTCGAGTTCATCTTGGAAAGCACGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000335200    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011609.4-1681s21c1
Sequence:CCGGCCTTAGGAAGAGGGACTTGAACTCGAGTTCAAGTCCCTCTTCCTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000335198    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011609.4-1025s21c1
Sequence:CCGGCCCGAAGTCTACTCCATCATTCTCGAGAATGATGGAGTAGACTTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066103    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_011609.2-1652s1c1
Sequence:CCGGCCTTAGGAAGAGGGACTTGAACTCGAGTTCAAGTCCCTCTTCCTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066107    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_011609.2-780s1c1
Sequence:CCGGGCAGGGTTCTTTCTGAGAGAACTCGAGTTCTCTCAGAAAGAACCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066104    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_011609.2-996s1c1
Sequence:CCGGCCCGAAGTCTACTCCATCATTCTCGAGAATGATGGAGTAGACTTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066105    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_011609.2-406s1c1
Sequence:CCGGCCCAAGGAAAGTATGTCCATTCTCGAGAATGGACATACTTTCCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066106    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_011609.2-1538s1c1
Sequence:CCGGCCTCGTGCTTTCCAAGATGAACTCGAGTTCATCTTGGAAAGCACGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011609
VALIDATED
TNFRSF1A MISSION shRNA Lentiviral Transduction Particles
tumor necrosis factor receptor superfamily, member 1A
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000348432    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011609.4-952s21c1
Sequence:CCGGGGTTATCTTGCTAGGTCTTTGCTCGAGCAAAGACCTAGCAAGATAACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000335199    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011609.4-1567s21c1
Sequence:CCGGCCTCGTGCTTTCCAAGATGAACTCGAGTTCATCTTGGAAAGCACGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000335200    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011609.4-1681s21c1
Sequence:CCGGCCTTAGGAAGAGGGACTTGAACTCGAGTTCAAGTCCCTCTTCCTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000335198    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011609.4-1025s21c1
Sequence:CCGGCCCGAAGTCTACTCCATCATTCTCGAGAATGATGGAGTAGACTTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066103    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_011609.2-1652s1c1
Sequence:CCGGCCTTAGGAAGAGGGACTTGAACTCGAGTTCAAGTCCCTCTTCCTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066107    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_011609.2-780s1c1
Sequence:CCGGGCAGGGTTCTTTCTGAGAGAACTCGAGTTCTCTCAGAAAGAACCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066104    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_011609.2-996s1c1
Sequence:CCGGCCCGAAGTCTACTCCATCATTCTCGAGAATGATGGAGTAGACTTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066105    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_011609.2-406s1c1
Sequence:CCGGCCCAAGGAAAGTATGTCCATTCTCGAGAATGGACATACTTTCCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066106    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_011609.2-1538s1c1
Sequence:CCGGCCTCGTGCTTTCCAAGATGAACTCGAGTTCATCTTGGAAAGCACGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks