EMAIL THIS PAGE TO A FRIEND

TNFRSF1B

tumor necrosis factor receptor superfamily, member 1B

Synonyms: CD120b TBPII TNF-R-II TNF-R75 TNFBR TNFR1B TNFR2 TNFR80 p75 p75TNFR
UniProtKB ID: P20333, B1AJZ3, Q16042, Q6YI29, Q9UIH1
Gene ID:
Human(7133) Summary: The protein encoded by this gene is a member of the TNF-receptor superfamily. This protein and TNF-receptor 1 form a heterocomplex that mediates the recruitment of two anti-apoptotic proteins, c-IAP1 and c-IAP2, which possess E3 ubiquitin ligase activity. The function of IAPs in TNF-receptor signalling is unknown, however, c-IAP1 is thought to potentiate TNF-induced apoptosis by the ubiquitination and degradation of TNF-receptor-associated factor 2, which mediates anti-apoptotic signals. Knockout studies in mice also suggest a role of this protein in protecting neurons from apoptosis by stimulating antioxidative pathways. [provided by RefSeq, Jul 2008]
Mouse(21938) tumor necrosis factor receptor superfamily, member 1b
Rat(156767) tumor necrosis factor receptor superfamily, member 1b
cow(338033) tumor necrosis factor receptor superfamily, member 1B
sheep(100240715) tumor necrosis factor receptor superfamily, member 1B
domestic guinea pig(100723273) tumor necrosis factor receptor superfamily, member 1B
naked mole-rat(101712824) tumor necrosis factor receptor superfamily, member 1B
Zebrafish(100037357) tumor necrosis factor receptor superfamily, member 1B
chicken(395083) tumor necrosis factor receptor superfamily, member 1B
dog(487437) tumor necrosis factor receptor superfamily, member 1B
domestic cat(101080392) tumor necrosis factor receptor superfamily, member 1B
98 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001066 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001066 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001066 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011610 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011610 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011610 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001066 Rosetta Predictions human pricing
NM_130426 Rosetta Predictions rat pricing
NM_011610 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001066 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00197288 predicted 919
2 SASI_Hs01_00197289 predicted 393
3 SASI_Hs01_00197290 predicted 200
4 SASI_Hs01_00197291 predicted 231
5 SASI_Hs01_00197292 predicted 934
6 SASI_Hs01_00197293 predicted 764
7 SASI_Hs01_00197294 predicted 548
8 SASI_Hs01_00197295 predicted 594
9 SASI_Hs01_00197297 predicted 333
10 SASI_Hs02_00311872 predicted 1273
11 SASI_Hs01_00197296 predicted 907
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_130426 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00267427 predicted 438
2 SASI_Rn02_00267428 predicted 420
3 SASI_Rn02_00267429 predicted 216
4 SASI_Rn02_00267430 predicted 358
5 SASI_Rn02_00267431 predicted 1010
6 SASI_Rn02_00267432 predicted 1165
7 SASI_Rn02_00267433 predicted 1018
8 SASI_Rn02_00267434 predicted 1536
9 SASI_Rn02_00267435 predicted 1441
10 SASI_Rn02_00267436 predicted 527
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011610 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00134451 predicted 966
2 SASI_Mm01_00134452 predicted 1534
3 SASI_Mm01_00134453 predicted 630
4 SASI_Mm01_00134454 predicted 775
5 SASI_Mm01_00134455 predicted 852
6 SASI_Mm01_00134456 predicted 1456
7 SASI_Mm01_00134457 predicted 1454
8 SASI_Mm01_00134458 predicted 635
9 SASI_Mm01_00134459 predicted 1569
10 SASI_Mm01_00134460 predicted 883
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001066
TNFRSF1B MISSION shRNA Bacterial Glycerol Stock
tumor necrosis factor receptor superfamily, member 1B
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000003771    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001066.x-989s1c1
Sequence:CCGGGCCTCACTTGCCTGCCGATAACTCGAGTTATCGGCAGGCAAGTGAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003773    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001066.x-897s1c1
Sequence:CCGGGCCTTGGGTCTACTAATAATACTCGAGTATTATTAGTAGACCCAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003772    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001066.x-3136s1c1
Sequence:CCGGCAGGGTGATAAATTGTTGATACTCGAGTATCAACAATTTATCACCCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010816    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001066.x-757s1c1
Sequence:CCGGGATCCCAACACACGCAGCCAACTCGAGTTGGCTGCGTGTGTTGGGATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000373788    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001066.2-602s21c1
Sequence:CCGGCACGACTTCATCCACGGATATCTCGAGATATCCGTGGATGAAGTCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000373790    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001066.2-1569s21c1
Sequence:CCGGCTAGGACTCTGAGGCTCTTTCCTCGAGGAAAGAGCCTCAGAGTCCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000373708    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001066.2-208s21c1
Sequence:CCGGGCCGGCTCAGAGAATACTATGCTCGAGCATAGTATTCTCTGAGCCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001066
TNFRSF1B MISSION shRNA shRNA Plasmid DNA
tumor necrosis factor receptor superfamily, member 1B
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000003771    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001066.x-989s1c1
Sequence:CCGGGCCTCACTTGCCTGCCGATAACTCGAGTTATCGGCAGGCAAGTGAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003773    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001066.x-897s1c1
Sequence:CCGGGCCTTGGGTCTACTAATAATACTCGAGTATTATTAGTAGACCCAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003772    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001066.x-3136s1c1
Sequence:CCGGCAGGGTGATAAATTGTTGATACTCGAGTATCAACAATTTATCACCCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010816    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001066.x-757s1c1
Sequence:CCGGGATCCCAACACACGCAGCCAACTCGAGTTGGCTGCGTGTGTTGGGATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000373788    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001066.2-602s21c1
Sequence:CCGGCACGACTTCATCCACGGATATCTCGAGATATCCGTGGATGAAGTCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000373790    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001066.2-1569s21c1
Sequence:CCGGCTAGGACTCTGAGGCTCTTTCCTCGAGGAAAGAGCCTCAGAGTCCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000373708    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001066.2-208s21c1
Sequence:CCGGGCCGGCTCAGAGAATACTATGCTCGAGCATAGTATTCTCTGAGCCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001066
TNFRSF1B MISSION shRNA Lentiviral Transduction Particles
tumor necrosis factor receptor superfamily, member 1B
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000003771    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001066.x-989s1c1
Sequence:CCGGGCCTCACTTGCCTGCCGATAACTCGAGTTATCGGCAGGCAAGTGAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003773    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001066.x-897s1c1
Sequence:CCGGGCCTTGGGTCTACTAATAATACTCGAGTATTATTAGTAGACCCAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003772    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001066.x-3136s1c1
Sequence:CCGGCAGGGTGATAAATTGTTGATACTCGAGTATCAACAATTTATCACCCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010816    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001066.x-757s1c1
Sequence:CCGGGATCCCAACACACGCAGCCAACTCGAGTTGGCTGCGTGTGTTGGGATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000373788    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001066.2-602s21c1
Sequence:CCGGCACGACTTCATCCACGGATATCTCGAGATATCCGTGGATGAAGTCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000373790    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001066.2-1569s21c1
Sequence:CCGGCTAGGACTCTGAGGCTCTTTCCTCGAGGAAAGAGCCTCAGAGTCCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000373708    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001066.2-208s21c1
Sequence:CCGGGCCGGCTCAGAGAATACTATGCTCGAGCATAGTATTCTCTGAGCCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011610
TNFRSF1B MISSION shRNA Bacterial Glycerol Stock
tumor necrosis factor receptor superfamily, member 1B
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000012318    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011610.1-826s1c1
Sequence:CCGGGCATCCTTACATCGTTGGGTTCTCGAGAACCCAACGATGTAAGGATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012319    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011610.1-1020s1c1
Sequence:CCGGCCTGATGAGAAATCCCAGGATCTCGAGATCCTGGGATTTCTCATCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012321    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011610.1-929s1c1
Sequence:CCGGGCTGATGTTAGGACTGGTGAACTCGAGTTCACCAGTCCTAACATCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012322    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011610.1-814s1c1
Sequence:CCGGGCCAAACTCCAAGCATCCTTACTCGAGTAAGGATGCTTGGAGTTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012320    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011610.1-264s1c1
Sequence:CCGGCCTGGCCAATATGTGAAACATCTCGAGATGTTTCACATATTGGCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011610
TNFRSF1B MISSION shRNA shRNA Plasmid DNA
tumor necrosis factor receptor superfamily, member 1B
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000012318    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011610.1-826s1c1
Sequence:CCGGGCATCCTTACATCGTTGGGTTCTCGAGAACCCAACGATGTAAGGATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012319    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011610.1-1020s1c1
Sequence:CCGGCCTGATGAGAAATCCCAGGATCTCGAGATCCTGGGATTTCTCATCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012321    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011610.1-929s1c1
Sequence:CCGGGCTGATGTTAGGACTGGTGAACTCGAGTTCACCAGTCCTAACATCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012322    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011610.1-814s1c1
Sequence:CCGGGCCAAACTCCAAGCATCCTTACTCGAGTAAGGATGCTTGGAGTTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012320    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011610.1-264s1c1
Sequence:CCGGCCTGGCCAATATGTGAAACATCTCGAGATGTTTCACATATTGGCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011610
TNFRSF1B MISSION shRNA Lentiviral Transduction Particles
tumor necrosis factor receptor superfamily, member 1B
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000012318    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011610.1-826s1c1
Sequence:CCGGGCATCCTTACATCGTTGGGTTCTCGAGAACCCAACGATGTAAGGATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012319    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011610.1-1020s1c1
Sequence:CCGGCCTGATGAGAAATCCCAGGATCTCGAGATCCTGGGATTTCTCATCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012321    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011610.1-929s1c1
Sequence:CCGGGCTGATGTTAGGACTGGTGAACTCGAGTTCACCAGTCCTAACATCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012322    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011610.1-814s1c1
Sequence:CCGGGCCAAACTCCAAGCATCCTTACTCGAGTAAGGATGCTTGGAGTTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012320    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011610.1-264s1c1
Sequence:CCGGCCTGGCCAATATGTGAAACATCTCGAGATGTTTCACATATTGGCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks