EMAIL THIS PAGE TO A FRIEND

TNFRSF21

tumor necrosis factor receptor superfamily, member 21

Synonyms: BM-018 CD358 DR6
UniProtKB ID: O75509, B2RDI9, Q0D2P5, Q96D86
Gene ID:
Human(27242) Summary: This gene encodes a member of the tumor necrosis factor receptor superfamily. The encoded protein activates nuclear factor kappa-B and mitogen-activated protein kinase 8 (also called c-Jun N-terminal kinase 1), and induces cell apoptosis. Through its death domain, the encoded receptor interacts with tumor necrosis factor receptor type 1-associated death domain (TRADD) protein, which is known to mediate signal transduction of tumor necrosis factor receptors. Knockout studies in mice suggest that this gene plays a role in T-helper cell activation, and may be involved in inflammation and immune regulation. [provided by RefSeq, Jul 2013]
Mouse(94185) tumor necrosis factor receptor superfamily, member 21
Rat(316256) tumor necrosis factor receptor superfamily, member 21
Zebrafish(564874) tumor necrosis factor receptor superfamily, member 21
Horse(100068460) tumor necrosis factor receptor superfamily, member 21
domestic cat(101090616) tumor necrosis factor receptor superfamily, member 21
dog(609964) tumor necrosis factor receptor superfamily, member 21
chicken(422062) tumor necrosis factor receptor superfamily, member 21
naked mole-rat(101713683) tumor necrosis factor receptor superfamily, member 21
Domestic Rabbit(100349758) tumor necrosis factor receptor superfamily, member 21
domestic guinea pig(100731666) tumor necrosis factor receptor superfamily, member 21
cow(537922) tumor necrosis factor receptor superfamily, member 21
sheep(101117284) tumor necrosis factor receptor superfamily, member 21
126 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014452 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014452 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014452 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_052975 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_052975 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_052975 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014452 Rosetta Predictions human pricing
NM_001108207 Rosetta Predictions rat pricing
NM_178589 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014452 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00109632 predicted 1712
2 SASI_Hs01_00109633 predicted 1191
3 SASI_Hs01_00109634 predicted 1519
4 SASI_Hs01_00109635 predicted 1292
5 SASI_Hs02_00345666 predicted 737
6 SASI_Hs01_00109637 predicted 648
7 SASI_Hs01_00109639 predicted 954
8 SASI_Hs01_00109640 predicted 1667
9 SASI_Hs01_00109641 predicted 649
10 SASI_Hs02_00345667 predicted 1434
11 SASI_Hs01_00109636 predicted 1214
12 SASI_Hs01_00109638 predicted 714
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108207 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00236374 predicted 633
2 SASI_Rn02_00236375 predicted 1462
3 SASI_Rn02_00236376 predicted 1483
4 SASI_Rn02_00236377 predicted 1528
5 SASI_Rn02_00236378 predicted 925
6 SASI_Rn02_00236379 predicted 662
7 SASI_Rn02_00236380 predicted 1808
8 SASI_Rn02_00236381 predicted 1921
9 SASI_Rn02_00236382 predicted 1732
10 SASI_Rn02_00236383 predicted 726
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178589 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00128738 predicted 1079
2 SASI_Mm01_00128739 predicted 1529
3 SASI_Mm01_00128740 predicted 2147
4 SASI_Mm01_00128741 predicted 1443
5 SASI_Mm01_00128742 predicted 622
6 SASI_Mm01_00128743 predicted 1197
7 SASI_Mm01_00128744 predicted 1740
8 SASI_Mm01_00128745 predicted 659
9 SASI_Mm01_00128746 predicted 1674
10 SASI_Mm01_00128747 predicted 1732
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014452
VALIDATED
TNFRSF21 MISSION shRNA Bacterial Glycerol Stock
tumor necrosis factor receptor superfamily, member 21
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000290467    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_014452.3-573s21c1
Sequence:CCGGCCTCGAATCTCATTGGCACATCTCGAGATGTGCCAATGAGATTCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000290468    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_014452.3-2221s21c1
Sequence:CCGGGCAGCCTATCTTTGATGACATCTCGAGATGTCATCAAAGATAGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000290470    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_014452.3-1200s21c1
Sequence:CCGGCCAACTCTTCTGCCTCTGTTACTCGAGTAACAGAGGCAGAAGAGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000290469    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_014452.3-654s21c1
Sequence:CCGGCCTATGTCTCTGAGCATTGTACTCGAGTACAATGCTCAGAGACATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059133    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_014452.3-2221s1c1
Sequence:CCGGGCAGCCTATCTTTGATGACATCTCGAGATGTCATCAAAGATAGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059134    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_014452.3-2010s1c1
Sequence:CCGGCCAACGCGAAACTTGAGAATTCTCGAGAATTCTCAAGTTTCGCGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059135    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_014452.3-654s1c1
Sequence:CCGGCCTATGTCTCTGAGCATTGTACTCGAGTACAATGCTCAGAGACATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059137    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_014452.3-1200s1c1
Sequence:CCGGCCAACTCTTCTGCCTCTGTTACTCGAGTAACAGAGGCAGAAGAGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059136    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_014452.3-573s1c1
Sequence:CCGGCCTCGAATCTCATTGGCACATCTCGAGATGTGCCAATGAGATTCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014452
VALIDATED
TNFRSF21 MISSION shRNA shRNA Plasmid DNA
tumor necrosis factor receptor superfamily, member 21
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000290467    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_014452.3-573s21c1
Sequence:CCGGCCTCGAATCTCATTGGCACATCTCGAGATGTGCCAATGAGATTCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000290468    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_014452.3-2221s21c1
Sequence:CCGGGCAGCCTATCTTTGATGACATCTCGAGATGTCATCAAAGATAGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000290470    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_014452.3-1200s21c1
Sequence:CCGGCCAACTCTTCTGCCTCTGTTACTCGAGTAACAGAGGCAGAAGAGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000290469    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_014452.3-654s21c1
Sequence:CCGGCCTATGTCTCTGAGCATTGTACTCGAGTACAATGCTCAGAGACATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059133    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_014452.3-2221s1c1
Sequence:CCGGGCAGCCTATCTTTGATGACATCTCGAGATGTCATCAAAGATAGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059134    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_014452.3-2010s1c1
Sequence:CCGGCCAACGCGAAACTTGAGAATTCTCGAGAATTCTCAAGTTTCGCGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059135    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_014452.3-654s1c1
Sequence:CCGGCCTATGTCTCTGAGCATTGTACTCGAGTACAATGCTCAGAGACATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059137    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_014452.3-1200s1c1
Sequence:CCGGCCAACTCTTCTGCCTCTGTTACTCGAGTAACAGAGGCAGAAGAGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059136    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_014452.3-573s1c1
Sequence:CCGGCCTCGAATCTCATTGGCACATCTCGAGATGTGCCAATGAGATTCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014452
VALIDATED
TNFRSF21 MISSION shRNA Lentiviral Transduction Particles
tumor necrosis factor receptor superfamily, member 21
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000290467    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_014452.3-573s21c1
Sequence:CCGGCCTCGAATCTCATTGGCACATCTCGAGATGTGCCAATGAGATTCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000290468    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_014452.3-2221s21c1
Sequence:CCGGGCAGCCTATCTTTGATGACATCTCGAGATGTCATCAAAGATAGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000290470    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_014452.3-1200s21c1
Sequence:CCGGCCAACTCTTCTGCCTCTGTTACTCGAGTAACAGAGGCAGAAGAGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000290469    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_014452.3-654s21c1
Sequence:CCGGCCTATGTCTCTGAGCATTGTACTCGAGTACAATGCTCAGAGACATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059133    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_014452.3-2221s1c1
Sequence:CCGGGCAGCCTATCTTTGATGACATCTCGAGATGTCATCAAAGATAGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059134    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_014452.3-2010s1c1
Sequence:CCGGCCAACGCGAAACTTGAGAATTCTCGAGAATTCTCAAGTTTCGCGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059135    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_014452.3-654s1c1
Sequence:CCGGCCTATGTCTCTGAGCATTGTACTCGAGTACAATGCTCAGAGACATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059137    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_014452.3-1200s1c1
Sequence:CCGGCCAACTCTTCTGCCTCTGTTACTCGAGTAACAGAGGCAGAAGAGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059136    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_014452.3-573s1c1
Sequence:CCGGCCTCGAATCTCATTGGCACATCTCGAGATGTGCCAATGAGATTCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_052975
TNFRSF21 MISSION shRNA Bacterial Glycerol Stock
tumor necrosis factor receptor superfamily, member 21
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000066598    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052975.1-1051s1c1
Sequence:CCGGCCCTTGATGATCGTTCTCTTTCTCGAGAAAGAGAACGATCATCAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066600    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052975.1-1570s1c1
Sequence:CCGGCCCAGTCCTAACGTGAAACTTCTCGAGAAGTTTCACGTTAGGACTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066601    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052975.1-1209s1c1
Sequence:CCGGCCGGGAGAAATGGATCTACTACTCGAGTAGTAGATCCATTTCTCCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066602    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052975.1-778s1c1
Sequence:CCGGGCCTCTGTTAGAACTAAGGTACTCGAGTACCTTAGTTCTAACAGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066599    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052975.1-403s1c1
Sequence:CCGGCCTGGAATGTATCAGTCTAATCTCGAGATTAGACTGATACATTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_052975
TNFRSF21 MISSION shRNA shRNA Plasmid DNA
tumor necrosis factor receptor superfamily, member 21
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000066598    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052975.1-1051s1c1
Sequence:CCGGCCCTTGATGATCGTTCTCTTTCTCGAGAAAGAGAACGATCATCAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066600    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052975.1-1570s1c1
Sequence:CCGGCCCAGTCCTAACGTGAAACTTCTCGAGAAGTTTCACGTTAGGACTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066601    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052975.1-1209s1c1
Sequence:CCGGCCGGGAGAAATGGATCTACTACTCGAGTAGTAGATCCATTTCTCCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066602    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052975.1-778s1c1
Sequence:CCGGGCCTCTGTTAGAACTAAGGTACTCGAGTACCTTAGTTCTAACAGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066599    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052975.1-403s1c1
Sequence:CCGGCCTGGAATGTATCAGTCTAATCTCGAGATTAGACTGATACATTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_052975
TNFRSF21 MISSION shRNA Lentiviral Transduction Particles
tumor necrosis factor receptor superfamily, member 21
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000066598    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052975.1-1051s1c1
Sequence:CCGGCCCTTGATGATCGTTCTCTTTCTCGAGAAAGAGAACGATCATCAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066600    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052975.1-1570s1c1
Sequence:CCGGCCCAGTCCTAACGTGAAACTTCTCGAGAAGTTTCACGTTAGGACTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066601    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052975.1-1209s1c1
Sequence:CCGGCCGGGAGAAATGGATCTACTACTCGAGTAGTAGATCCATTTCTCCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066602    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052975.1-778s1c1
Sequence:CCGGGCCTCTGTTAGAACTAAGGTACTCGAGTACCTTAGTTCTAACAGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066599    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052975.1-403s1c1
Sequence:CCGGCCTGGAATGTATCAGTCTAATCTCGAGATTAGACTGATACATTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks