EMAIL THIS PAGE TO A FRIEND

TNFRSF25

tumor necrosis factor receptor superfamily, member 25

Synonyms: APO-3 DDR3 DR3 LARD TNFRSF12 TR3 TRAMP WSL-1 WSL-LR
Gene ID:
Human(8718) Summary: The protein encoded by this gene is a member of the TNF-receptor superfamily. This receptor is expressed preferentially in the tissues enriched in lymphocytes, and it may play a role in regulating lymphocyte homeostasis. This receptor has been shown to stimulate NF-kappa B activity and regulate cell apoptosis. The signal transduction of this receptor is mediated by various death domain containing adaptor proteins. Knockout studies in mice suggested the role of this gene in the removal of self-reactive T cells in the thymus. Multiple alternatively spliced transcript variants of this gene encoding distinct isoforms have been reported, most of which are potentially secreted molecules. The alternative splicing of this gene in B and T cells encounters a programmed change upon T-cell activation, which predominantly produces full-length, membrane bound isoforms, and is thought to be involved in controlling lymphocyte proliferation induced by T-cell activation. [provided by RefSeq, Jul 2008]
Mouse(85030) tumor necrosis factor receptor superfamily, member 25
Rat(500592) tumor necrosis factor receptor superfamily, member 25
cow(783432) tumor necrosis factor receptor superfamily, member 25
sheep(101116668) tumor necrosis factor receptor superfamily, member 25
domestic guinea pig(100724303) tumor necrosis factor receptor superfamily, member 25
naked mole-rat(101703558) tumor necrosis factor receptor superfamily, member 25
chicken(425564) tumor necrosis factor receptor superfamily, member 25
dog(489632) tumor necrosis factor receptor superfamily, member 25
domestic cat(101090784) tumor necrosis factor receptor superfamily, member 25
148 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

ELISA

Product # Description Species Add to Cart
 
RAB1421 Human DR3 ELISA for serum, plasma and cell culture supernatants human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_033042 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_033042 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_033042 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_003790 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003790 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003790 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU088751 MISSION® esiRNA esiRNA targeting mouse Tnfrsf25 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001039664 Rosetta Predictions human pricing
NM_003790 Rosetta Predictions human pricing
NM_148965 Rosetta Predictions human pricing
NM_148966 Rosetta Predictions human pricing
NM_148967 Rosetta Predictions human pricing
NM_148970 Rosetta Predictions human pricing
XM_001076437 Rosetta Predictions rat pricing
XM_575965 Rosetta Predictions rat pricing
NM_033042 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039664 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00178745 predicted 378
2 SASI_Hs01_00178746 predicted 384
3 SASI_Hs01_00178747 predicted 327
4 SASI_Hs01_00178748 predicted 331
5 SASI_Hs01_00178749 predicted 390
6 SASI_Hs01_00178750 predicted 385
7 SASI_Hs01_00178751 predicted 811
8 SASI_Hs01_00178752 predicted 482
9 SASI_Hs01_00178753 predicted 543
10 SASI_Hs02_00308627 predicted 772
11 SASI_Hs01_00178754 predicted 833
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003790 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00144117 predicted 1019
2 SASI_Hs01_00144118 predicted 1246
3 SASI_Hs01_00144119 predicted 1082
4 SASI_Hs01_00144120 predicted 1327
5 SASI_Hs01_00144121 predicted 1351
6 SASI_Hs01_00144122 predicted 1344
7 SASI_Hs01_00144123 predicted 1316
8 SASI_Hs01_00144125 predicted 1289
9 SASI_Hs01_00144126 predicted 1337
10 SASI_Hs02_00336296 predicted 1055
11 SASI_Hs01_00144124 predicted 1197
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_148965 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00042742 predicted 1051
2 SASI_Hs01_00042743 predicted 1266
3 SASI_Hs01_00042744 predicted 1108
4 SASI_Hs01_00042745 predicted 1360
5 SASI_Hs01_00042746 predicted 1370
6 SASI_Hs01_00042747 predicted 1366
7 SASI_Hs01_00042748 predicted 1342
8 SASI_Hs01_00042750 predicted 1310
9 SASI_Hs01_00042751 predicted 1359
10 SASI_Hs02_00365685 predicted 1078
11 SASI_Hs01_00042749 predicted 1229
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_148966 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00195183 predicted 913
2 SASI_Hs01_00195184 predicted 1133
3 SASI_Hs01_00195185 predicted 964
4 SASI_Hs01_00195186 predicted 1215
5 SASI_Hs01_00195187 predicted 1240
6 SASI_Hs01_00195188 predicted 1232
7 SASI_Hs01_00195189 predicted 1205
8 SASI_Hs01_00195191 predicted 1174
9 SASI_Hs01_00195192 predicted 1220
10 SASI_Hs02_00365686 predicted 935
11 SASI_Hs01_00195190 predicted 1086
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_148967 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00138564 predicted 886
2 SASI_Hs01_00138565 predicted 1103
3 SASI_Hs01_00138566 predicted 942
4 SASI_Hs01_00138567 predicted 1193
5 SASI_Hs01_00138568 predicted 1211
6 SASI_Hs01_00138569 predicted 1206
7 SASI_Hs01_00138570 predicted 1180
8 SASI_Hs01_00138572 predicted 1153
9 SASI_Hs01_00138573 predicted 1202
10 SASI_Hs02_00365687 predicted 914
11 SASI_Hs01_00138571 predicted 1071
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_148970 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00226115 predicted 473
2 SASI_Hs01_00226116 predicted 691
3 SASI_Hs01_00226117 predicted 529
4 SASI_Hs01_00226118 predicted 780
5 SASI_Hs01_00226119 predicted 800
6 SASI_Hs01_00226120 predicted 789
7 SASI_Hs01_00226121 predicted 771
8 SASI_Hs01_00226123 predicted 740
9 SASI_Hs01_00226124 predicted 782
10 SASI_Hs02_00365688 predicted 499
11 SASI_Hs01_00226122 predicted 648
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001076437 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00353216 predicted 652
2 SASI_Rn02_00353217 predicted 691
3 SASI_Rn02_00353218 predicted 1456
4 SASI_Rn02_00353219 predicted 1475
5 SASI_Rn02_00353220 predicted 475
6 SASI_Rn02_00353221 predicted 572
7 SASI_Rn02_00353222 predicted 567
8 SASI_Rn02_00353223 predicted 1294
9 SASI_Rn02_00353224 predicted 321
10 SASI_Rn02_00353225 predicted 1423
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_575965 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00404577 predicted 654
2 SASI_Rn02_00404578 predicted 684
3 SASI_Rn02_00404579 predicted 635
4 SASI_Rn02_00404580 predicted 476
5 SASI_Rn02_00404581 predicted 575
6 SASI_Rn02_00404582 predicted 561
7 SASI_Rn02_00404583 predicted 328
8 SASI_Rn02_00404584 predicted 484
9 SASI_Rn02_00404585 predicted 824
10 SASI_Rn02_00404586 predicted 517
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033042 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00194995 predicted 724
2 SASI_Mm02_00337270 predicted 525
3 SASI_Mm02_00337271 predicted 1341
4 SASI_Mm01_00195003 predicted 855
5 SASI_Mm01_00195000 predicted 1375
6 SASI_Mm02_00337272 predicted 894
7 SASI_Mm01_00195004 predicted 510
8 SASI_Mm02_00337273 predicted 1101
9 SASI_Mm02_00337274 predicted 1187
10 SASI_Mm02_00337275 predicted 1070
11 SASI_Mm01_00194996 predicted 755
12 SASI_Mm01_00194997 predicted 783
13 SASI_Mm01_00194998 predicted 818
14 SASI_Mm01_00194999 predicted 695
15 SASI_Mm01_00195001 predicted 1392
16 SASI_Mm01_00195002 predicted 636
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_033042
TNFRSF25 MISSION shRNA Bacterial Glycerol Stock
tumor necrosis factor receptor superfamily, member 25
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000432655    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033042.3-896s21c1
Sequence:CCGGTGTCCAGTTGGTAGGCAACAACTCGAGTTGTTGCCTACCAACTGGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428121    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033042.3-459s21c1
Sequence:CCGGACCAGAGACAACCACTTTAAGCTCGAGCTTAAAGTGGTTGTCTCTGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425440    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033042.3-218s21c1
Sequence:CCGGAGGGTCAACTGCACGTGTTCTCTCGAGAGAACACGTGCAGTTGACCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421647    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033042.3-1334s21c1
Sequence:CCGGGAAGGTCCATCAGCCACTTTGCTCGAGCAAAGTGGCTGATGGACCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012333    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033042.2-1439s1c1
Sequence:CCGGGTATTGTTACTTATGCGTGTACTCGAGTACACGCATAAGTAACAATACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012336    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033042.2-435s1c1
Sequence:CCGGCGCTGCCAAGTCTGTGATGAACTCGAGTTCATCACAGACTTGGCAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012337    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033042.2-1131s1c1
Sequence:CCGGCAGCTCTACGATGTGATGGATCTCGAGATCCATCACATCGTAGAGCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012335    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033042.2-1250s1c1
Sequence:CCGGCCAGCAGTATGAGATGCTCAACTCGAGTTGAGCATCTCATACTGCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012334    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033042.2-780s1c1
Sequence:CCGGGCTATCCTGATCTGTGCATATCTCGAGATATGCACAGATCAGGATAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_033042
TNFRSF25 MISSION shRNA shRNA Plasmid DNA
tumor necrosis factor receptor superfamily, member 25
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000432655    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033042.3-896s21c1
Sequence:CCGGTGTCCAGTTGGTAGGCAACAACTCGAGTTGTTGCCTACCAACTGGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428121    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033042.3-459s21c1
Sequence:CCGGACCAGAGACAACCACTTTAAGCTCGAGCTTAAAGTGGTTGTCTCTGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425440    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033042.3-218s21c1
Sequence:CCGGAGGGTCAACTGCACGTGTTCTCTCGAGAGAACACGTGCAGTTGACCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421647    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033042.3-1334s21c1
Sequence:CCGGGAAGGTCCATCAGCCACTTTGCTCGAGCAAAGTGGCTGATGGACCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012333    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033042.2-1439s1c1
Sequence:CCGGGTATTGTTACTTATGCGTGTACTCGAGTACACGCATAAGTAACAATACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012336    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033042.2-435s1c1
Sequence:CCGGCGCTGCCAAGTCTGTGATGAACTCGAGTTCATCACAGACTTGGCAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012337    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033042.2-1131s1c1
Sequence:CCGGCAGCTCTACGATGTGATGGATCTCGAGATCCATCACATCGTAGAGCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012335    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033042.2-1250s1c1
Sequence:CCGGCCAGCAGTATGAGATGCTCAACTCGAGTTGAGCATCTCATACTGCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012334    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033042.2-780s1c1
Sequence:CCGGGCTATCCTGATCTGTGCATATCTCGAGATATGCACAGATCAGGATAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_033042
TNFRSF25 MISSION shRNA Lentiviral Transduction Particles
tumor necrosis factor receptor superfamily, member 25
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000432655    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033042.3-896s21c1
Sequence:CCGGTGTCCAGTTGGTAGGCAACAACTCGAGTTGTTGCCTACCAACTGGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428121    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033042.3-459s21c1
Sequence:CCGGACCAGAGACAACCACTTTAAGCTCGAGCTTAAAGTGGTTGTCTCTGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425440    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033042.3-218s21c1
Sequence:CCGGAGGGTCAACTGCACGTGTTCTCTCGAGAGAACACGTGCAGTTGACCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421647    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033042.3-1334s21c1
Sequence:CCGGGAAGGTCCATCAGCCACTTTGCTCGAGCAAAGTGGCTGATGGACCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012333    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033042.2-1439s1c1
Sequence:CCGGGTATTGTTACTTATGCGTGTACTCGAGTACACGCATAAGTAACAATACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012336    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033042.2-435s1c1
Sequence:CCGGCGCTGCCAAGTCTGTGATGAACTCGAGTTCATCACAGACTTGGCAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012337    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033042.2-1131s1c1
Sequence:CCGGCAGCTCTACGATGTGATGGATCTCGAGATCCATCACATCGTAGAGCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012335    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033042.2-1250s1c1
Sequence:CCGGCCAGCAGTATGAGATGCTCAACTCGAGTTGAGCATCTCATACTGCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012334    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033042.2-780s1c1
Sequence:CCGGGCTATCCTGATCTGTGCATATCTCGAGATATGCACAGATCAGGATAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003790
TNFRSF25 MISSION shRNA Bacterial Glycerol Stock
tumor necrosis factor receptor superfamily, member 25
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000429818    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003790.2-894s21c1
Sequence:CCGGAGAAGATCTGCACCGTCCAGTCTCGAGACTGGACGGTGCAGATCTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421016    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003790.2-1398s21c1
Sequence:CCGGACGGTTACTTATGCGTGTAGACTCGAGTCTACACGCATAAGTAACCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427415    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003790.2-496s21c1
Sequence:CCGGCTACTGCCAACCATGCCTAGACTCGAGTCTAGGCATGGTTGGCAGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058508    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003790.2-205s1c1
Sequence:CCGGCCACAAGAAGATTGGTCTGTTCTCGAGAACAGACCAATCTTCTTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058512    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003790.2-196s1c1
Sequence:CCGGCGGTGACTTCCACAAGAAGATCTCGAGATCTTCTTGTGGAAGTCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058509    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003790.2-327s1c1
Sequence:CCGGCCTGGGAGAACCACCATAATTCTCGAGAATTATGGTGGTTCTCCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058510    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003790.2-468s1c1
Sequence:CCGGTCAGCCAATGTGTCAGCAGTTCTCGAGAACTGCTGACACATTGGCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058511    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003790.2-1207s1c1
Sequence:CCGGCCAGCAGTACGAGATGCTCAACTCGAGTTGAGCATCTCGTACTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003790
TNFRSF25 MISSION shRNA shRNA Plasmid DNA
tumor necrosis factor receptor superfamily, member 25
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000429818    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003790.2-894s21c1
Sequence:CCGGAGAAGATCTGCACCGTCCAGTCTCGAGACTGGACGGTGCAGATCTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421016    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003790.2-1398s21c1
Sequence:CCGGACGGTTACTTATGCGTGTAGACTCGAGTCTACACGCATAAGTAACCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427415    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003790.2-496s21c1
Sequence:CCGGCTACTGCCAACCATGCCTAGACTCGAGTCTAGGCATGGTTGGCAGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058508    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003790.2-205s1c1
Sequence:CCGGCCACAAGAAGATTGGTCTGTTCTCGAGAACAGACCAATCTTCTTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058512    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003790.2-196s1c1
Sequence:CCGGCGGTGACTTCCACAAGAAGATCTCGAGATCTTCTTGTGGAAGTCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058509    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003790.2-327s1c1
Sequence:CCGGCCTGGGAGAACCACCATAATTCTCGAGAATTATGGTGGTTCTCCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058510    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003790.2-468s1c1
Sequence:CCGGTCAGCCAATGTGTCAGCAGTTCTCGAGAACTGCTGACACATTGGCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058511    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003790.2-1207s1c1
Sequence:CCGGCCAGCAGTACGAGATGCTCAACTCGAGTTGAGCATCTCGTACTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003790
TNFRSF25 MISSION shRNA Lentiviral Transduction Particles
tumor necrosis factor receptor superfamily, member 25
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000429818    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003790.2-894s21c1
Sequence:CCGGAGAAGATCTGCACCGTCCAGTCTCGAGACTGGACGGTGCAGATCTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421016    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003790.2-1398s21c1
Sequence:CCGGACGGTTACTTATGCGTGTAGACTCGAGTCTACACGCATAAGTAACCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427415    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003790.2-496s21c1
Sequence:CCGGCTACTGCCAACCATGCCTAGACTCGAGTCTAGGCATGGTTGGCAGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058508    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003790.2-205s1c1
Sequence:CCGGCCACAAGAAGATTGGTCTGTTCTCGAGAACAGACCAATCTTCTTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058512    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003790.2-196s1c1
Sequence:CCGGCGGTGACTTCCACAAGAAGATCTCGAGATCTTCTTGTGGAAGTCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058509    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003790.2-327s1c1
Sequence:CCGGCCTGGGAGAACCACCATAATTCTCGAGAATTATGGTGGTTCTCCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058510    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003790.2-468s1c1
Sequence:CCGGTCAGCCAATGTGTCAGCAGTTCTCGAGAACTGCTGACACATTGGCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058511    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003790.2-1207s1c1
Sequence:CCGGCCAGCAGTACGAGATGCTCAACTCGAGTTGAGCATCTCGTACTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks