EMAIL THIS PAGE TO A FRIEND

TNFRSF4

tumor necrosis factor receptor superfamily, member 4

Synonyms: ACT35 CD134 OX40 TXGP1L
UniProtKB ID: P43489, Q13663, Q2M312, Q5T7M0
Gene ID:
Human(7293) Summary: The protein encoded by this gene is a member of the TNF-receptor superfamily. This receptor has been shown to activate NF-kappaB through its interaction with adaptor proteins TRAF2 and TRAF5. Knockout studies in mice suggested that this receptor promotes the expression of apoptosis inhibitors BCL2 and BCL2lL1/BCL2-XL, and thus suppresses apoptosis. The knockout studies also suggested the roles of this receptor in CD4+ T cell response, as well as in T cell-dependent B cell proliferation and differentiation. [provided by RefSeq, Jul 2008]
Mouse(22163) tumor necrosis factor receptor superfamily, member 4
Rat(25572) tumor necrosis factor receptor superfamily, member 4
cow(528782) tumor necrosis factor receptor superfamily, member 4
sheep(101108407) tumor necrosis factor receptor superfamily, member 4
domestic guinea pig(100715179) tumor necrosis factor receptor superfamily, member 4
naked mole-rat(101714706) tumor necrosis factor receptor superfamily, member 4
Domestic Rabbit(100009449) tumor necrosis factor receptor superfamily, member 4
chicken(101665445) tumor necrosis factor receptor superfamily, member 4
domestic cat(493665) tumor necrosis factor receptor superfamily, member 4
dog(489600) tumor necrosis factor receptor superfamily, member 4
chicken(101751037) tumor necrosis factor receptor superfamily, member 4
Gene Class: Apoptosis
49 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2107361 Anti-TNFRSF4 antibody produced in rabbit affinity isolated antibody human
ELISA, western blot pricing
SAB4503049 Anti-TNR4, C-Terminal antibody produced in rabbit affinity isolated antibody human, mouse, rat
ELISA, immunofluorescence pricing

ELISA

Product # Description Species Add to Cart
 
RAB1622 Human OX40 ELISA for serum, plasma and cell culture supernatants human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_011659 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011659 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011659 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_003327 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003327 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003327 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003327 Rosetta Predictions human pricing
NM_013049 Rosetta Predictions rat pricing
NM_011659 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003327 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00187961 predicted 222
2 SASI_Hs01_00187962 predicted 235
3 SASI_Hs01_00187963 predicted 247
4 SASI_Hs01_00187964 predicted 203
5 SASI_Hs01_00187965 predicted 204
6 SASI_Hs01_00187966 predicted 204
7 SASI_Hs01_00187967 predicted 200
8 SASI_Hs02_00335471 predicted 349
9 SASI_Hs02_00335472 predicted 711
10 SASI_Hs02_00335473 predicted 471
11 SASI_Hs01_00187968 predicted 809
12 SASI_Hs01_00187969 predicted 818
13 SASI_Hs01_00187970 predicted 590
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013049 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00061553 predicted 472
2 SASI_Rn01_00061554 predicted 296
3 SASI_Rn02_00260775 predicted 717
4 SASI_Rn01_00061555 predicted 481
5 SASI_Rn01_00061556 predicted 562
6 SASI_Rn01_00061557 predicted 361
7 SASI_Rn01_00061558 predicted 472
8 SASI_Rn01_00061559 predicted 286
9 SASI_Rn01_00061561 predicted 264
10 SASI_Rn01_00061562 predicted 355
11 SASI_Rn01_00061560 predicted 292
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011659 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00159547 predicted 465
2 SASI_Mm01_00159548 predicted 436
3 SASI_Mm01_00159549 predicted 376
4 SASI_Mm01_00159551 predicted 866
5 SASI_Mm01_00159553 predicted 893
6 SASI_Mm01_00159554 predicted 366
7 SASI_Mm02_00321154 predicted 338
8 SASI_Mm01_00159555 predicted 860
9 SASI_Mm01_00159556 predicted 454
10 SASI_Mm02_00321155 predicted 710
11 SASI_Mm01_00159550 predicted 528
12 SASI_Mm01_00159552 predicted 362
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011659
TNFRSF4 MISSION shRNA Bacterial Glycerol Stock
tumor necrosis factor receptor superfamily, member 4
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000066194    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011659.1-601s1c1
Sequence:CCGGCCTGGACCAATTGTACCTTATCTCGAGATAAGGTACAATTGGTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066195    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011659.1-890s1c1
Sequence:CCGGGAAGGCTTGGAGATTGCCTAACTCGAGTTAGGCAATCTCCAAGCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066196    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011659.1-254s1c1
Sequence:CCGGCAACTGTGTTAAACATACCTACTCGAGTAGGTATGTTTAACACAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066197    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011659.1-451s1c1
Sequence:CCGGTCAAGCAGAATTGCACACCTACTCGAGTAGGTGTGCAATTCTGCTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066193    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011659.1-331s1c1
Sequence:CCGGGCTGTGATCATACCAGGGATACTCGAGTATCCCTGGTATGATCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011659
TNFRSF4 MISSION shRNA shRNA Plasmid DNA
tumor necrosis factor receptor superfamily, member 4
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000066194    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011659.1-601s1c1
Sequence:CCGGCCTGGACCAATTGTACCTTATCTCGAGATAAGGTACAATTGGTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066195    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011659.1-890s1c1
Sequence:CCGGGAAGGCTTGGAGATTGCCTAACTCGAGTTAGGCAATCTCCAAGCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066196    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011659.1-254s1c1
Sequence:CCGGCAACTGTGTTAAACATACCTACTCGAGTAGGTATGTTTAACACAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066197    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011659.1-451s1c1
Sequence:CCGGTCAAGCAGAATTGCACACCTACTCGAGTAGGTGTGCAATTCTGCTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066193    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011659.1-331s1c1
Sequence:CCGGGCTGTGATCATACCAGGGATACTCGAGTATCCCTGGTATGATCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011659
TNFRSF4 MISSION shRNA Lentiviral Transduction Particles
tumor necrosis factor receptor superfamily, member 4
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000066194    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011659.1-601s1c1
Sequence:CCGGCCTGGACCAATTGTACCTTATCTCGAGATAAGGTACAATTGGTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066195    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011659.1-890s1c1
Sequence:CCGGGAAGGCTTGGAGATTGCCTAACTCGAGTTAGGCAATCTCCAAGCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066196    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011659.1-254s1c1
Sequence:CCGGCAACTGTGTTAAACATACCTACTCGAGTAGGTATGTTTAACACAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066197    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011659.1-451s1c1
Sequence:CCGGTCAAGCAGAATTGCACACCTACTCGAGTAGGTGTGCAATTCTGCTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066193    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011659.1-331s1c1
Sequence:CCGGGCTGTGATCATACCAGGGATACTCGAGTATCCCTGGTATGATCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003327
TNFRSF4 MISSION shRNA Bacterial Glycerol Stock
tumor necrosis factor receptor superfamily, member 4
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000058910    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003327.2-479s1c1
Sequence:CCGGCAGCAATAGCTCGGACGCAATCTCGAGATTGCGTCCGAGCTATTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058911    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003327.2-134s1c1
Sequence:CCGGCCACGAGTGCAGGCCAGGCAACTCGAGTTGCCTGGCCTGCACTCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058912    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003327.2-592s1c1
Sequence:CCGGCCAGAACCTCACAGGGACCCTCTCGAGAGGGTCCCTGTGAGGTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058909    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003327.2-354s1c1
Sequence:CCGGGACAGCTACAAGCCTGGAGTTCTCGAGAACTCCAGGCTTGTAGCTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058908    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003327.2-256s1c1
Sequence:CCGGGCACGTGGTGTAACCTCAGAACTCGAGTTCTGAGGTTACACCACGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000437843    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003327.2-214s21c1
Sequence:CCGGGCTTCTACAACGACGTGGTCACTCGAGTGACCACGTCGTTGTAGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430629    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003327.2-491s21c1
Sequence:CCGGGGACGCAATCTGTGAGGACAGCTCGAGCTGTCCTCACAGATTGCGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431258    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003327.2-268s21c1
Sequence:CCGGACCTCAGAAGTGGGAGTGAGCCTCGAGGCTCACTCCCACTTCTGAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003327
TNFRSF4 MISSION shRNA shRNA Plasmid DNA
tumor necrosis factor receptor superfamily, member 4
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000058910    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003327.2-479s1c1
Sequence:CCGGCAGCAATAGCTCGGACGCAATCTCGAGATTGCGTCCGAGCTATTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058911    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003327.2-134s1c1
Sequence:CCGGCCACGAGTGCAGGCCAGGCAACTCGAGTTGCCTGGCCTGCACTCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058912    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003327.2-592s1c1
Sequence:CCGGCCAGAACCTCACAGGGACCCTCTCGAGAGGGTCCCTGTGAGGTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058909    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003327.2-354s1c1
Sequence:CCGGGACAGCTACAAGCCTGGAGTTCTCGAGAACTCCAGGCTTGTAGCTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058908    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003327.2-256s1c1
Sequence:CCGGGCACGTGGTGTAACCTCAGAACTCGAGTTCTGAGGTTACACCACGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000437843    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003327.2-214s21c1
Sequence:CCGGGCTTCTACAACGACGTGGTCACTCGAGTGACCACGTCGTTGTAGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430629    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003327.2-491s21c1
Sequence:CCGGGGACGCAATCTGTGAGGACAGCTCGAGCTGTCCTCACAGATTGCGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431258    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003327.2-268s21c1
Sequence:CCGGACCTCAGAAGTGGGAGTGAGCCTCGAGGCTCACTCCCACTTCTGAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003327
TNFRSF4 MISSION shRNA Lentiviral Transduction Particles
tumor necrosis factor receptor superfamily, member 4
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000058910    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003327.2-479s1c1
Sequence:CCGGCAGCAATAGCTCGGACGCAATCTCGAGATTGCGTCCGAGCTATTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058911    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003327.2-134s1c1
Sequence:CCGGCCACGAGTGCAGGCCAGGCAACTCGAGTTGCCTGGCCTGCACTCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058912    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003327.2-592s1c1
Sequence:CCGGCCAGAACCTCACAGGGACCCTCTCGAGAGGGTCCCTGTGAGGTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058909    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003327.2-354s1c1
Sequence:CCGGGACAGCTACAAGCCTGGAGTTCTCGAGAACTCCAGGCTTGTAGCTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058908    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003327.2-256s1c1
Sequence:CCGGGCACGTGGTGTAACCTCAGAACTCGAGTTCTGAGGTTACACCACGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000437843    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003327.2-214s21c1
Sequence:CCGGGCTTCTACAACGACGTGGTCACTCGAGTGACCACGTCGTTGTAGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430629    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003327.2-491s21c1
Sequence:CCGGGGACGCAATCTGTGAGGACAGCTCGAGCTGTCCTCACAGATTGCGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431258    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003327.2-268s21c1
Sequence:CCGGACCTCAGAAGTGGGAGTGAGCCTCGAGGCTCACTCCCACTTCTGAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks