EMAIL THIS PAGE TO A FRIEND

TNFRSF6B

tumor necrosis factor receptor superfamily, member 6b, decoy

Synonyms: DCR3 DJ583P15.1.1 M68 M68E TR6
UniProtKB ID: O95407
Gene ID:
Human(8771) Summary: This gene belongs to the tumor necrosis factor receptor superfamily. The encoded protein is postulated to play a regulatory role in suppressing FasL- and LIGHT-mediated cell death. It acts as a decoy receptor that competes with death receptors for ligand binding. Over-expression of this gene has been noted in gastrointestinal tract tumors. Read-through transcription into this gene from the neighboring upstream gene, which encodes regulator of telomere elongation helicase 1 (RTEL1), generates a non-coding transcript. [provided by RefSeq, Feb 2011]
chicken(395096) tumor necrosis factor receptor superfamily, member 6b, decoy
naked mole-rat(101727172) tumor necrosis factor receptor superfamily, member 6b, decoy
domestic guinea pig(100716040) tumor necrosis factor receptor superfamily, member 6b, decoy
cow(789154) tumor necrosis factor receptor superfamily, member 6b, decoy
sheep(101117352) tumor necrosis factor receptor superfamily, member 6b, decoy
36 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003823 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003823 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003823 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003823 Rosetta Predictions human pricing
NM_032945 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003823 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00227189 predicted 735
2 SASI_Hs01_00227190 predicted 648
3 SASI_Hs01_00227191 predicted 322
4 SASI_Hs01_00227192 predicted 759
5 SASI_Hs01_00227193 predicted 477
6 SASI_Hs01_00227194 predicted 723
7 SASI_Hs01_00227195 predicted 662
8 SASI_Hs01_00227196 predicted 719
9 SASI_Hs01_00227197 predicted 295
10 SASI_Hs01_00227198 predicted 526
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032945 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00190437 predicted 1067
2 SASI_Hs01_00190438 predicted 978
3 SASI_Hs01_00190439 predicted 655
4 SASI_Hs01_00190440 predicted 1091
5 SASI_Hs01_00190441 predicted 815
6 SASI_Hs01_00190442 predicted 1061
7 SASI_Hs01_00190443 predicted 992
8 SASI_Hs01_00190444 predicted 1060
9 SASI_Hs01_00190445 predicted 634
10 SASI_Hs01_00190446 predicted 863
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003823
TNFRSF6B MISSION shRNA Bacterial Glycerol Stock
tumor necrosis factor receptor superfamily, member 6b, decoy
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000436822    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003823.2-734s21c1
Sequence:CCGGGAGCGTGCCGTCATCGACTTTCTCGAGAAAGTCGATGACGGCACGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433565    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003823.2-178s21c1
Sequence:CCGGTGTACGCGGAGTGGCAGAAACCTCGAGGTTTCTGCCACTCCGCGTACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058903    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003823.2-742s1c1
Sequence:CCGGCGTCATCGACTTTGTGGCTTTCTCGAGAAAGCCACAAAGTCGATGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058904    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003823.2-331s1c1
Sequence:CCGGCTACACGCAGTTCTGGAACTACTCGAGTAGTTCCAGAACTGCGTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058905    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003823.2-639s1c1
Sequence:CCGGCCCTCAATGTGCCAGGCTCTTCTCGAGAAGAGCCTGGCACATTGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058907    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003823.2-466s1c1
Sequence:CCGGCGCTGGTTTCTGCTTGGAGCACTCGAGTGCTCCAAGCAGAAACCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058906    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003823.2-751s1c1
Sequence:CCGGCTTTGTGGCTTTCCAGGACATCTCGAGATGTCCTGGAAAGCCACAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003823
TNFRSF6B MISSION shRNA shRNA Plasmid DNA
tumor necrosis factor receptor superfamily, member 6b, decoy
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000436822    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003823.2-734s21c1
Sequence:CCGGGAGCGTGCCGTCATCGACTTTCTCGAGAAAGTCGATGACGGCACGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433565    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003823.2-178s21c1
Sequence:CCGGTGTACGCGGAGTGGCAGAAACCTCGAGGTTTCTGCCACTCCGCGTACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058903    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003823.2-742s1c1
Sequence:CCGGCGTCATCGACTTTGTGGCTTTCTCGAGAAAGCCACAAAGTCGATGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058904    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003823.2-331s1c1
Sequence:CCGGCTACACGCAGTTCTGGAACTACTCGAGTAGTTCCAGAACTGCGTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058905    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003823.2-639s1c1
Sequence:CCGGCCCTCAATGTGCCAGGCTCTTCTCGAGAAGAGCCTGGCACATTGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058907    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003823.2-466s1c1
Sequence:CCGGCGCTGGTTTCTGCTTGGAGCACTCGAGTGCTCCAAGCAGAAACCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058906    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003823.2-751s1c1
Sequence:CCGGCTTTGTGGCTTTCCAGGACATCTCGAGATGTCCTGGAAAGCCACAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003823
TNFRSF6B MISSION shRNA Lentiviral Transduction Particles
tumor necrosis factor receptor superfamily, member 6b, decoy
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000436822    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003823.2-734s21c1
Sequence:CCGGGAGCGTGCCGTCATCGACTTTCTCGAGAAAGTCGATGACGGCACGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433565    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003823.2-178s21c1
Sequence:CCGGTGTACGCGGAGTGGCAGAAACCTCGAGGTTTCTGCCACTCCGCGTACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058903    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003823.2-742s1c1
Sequence:CCGGCGTCATCGACTTTGTGGCTTTCTCGAGAAAGCCACAAAGTCGATGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058904    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003823.2-331s1c1
Sequence:CCGGCTACACGCAGTTCTGGAACTACTCGAGTAGTTCCAGAACTGCGTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058905    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003823.2-639s1c1
Sequence:CCGGCCCTCAATGTGCCAGGCTCTTCTCGAGAAGAGCCTGGCACATTGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058907    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003823.2-466s1c1
Sequence:CCGGCGCTGGTTTCTGCTTGGAGCACTCGAGTGCTCCAAGCAGAAACCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058906    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003823.2-751s1c1
Sequence:CCGGCTTTGTGGCTTTCCAGGACATCTCGAGATGTCCTGGAAAGCCACAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks