EMAIL THIS PAGE TO A FRIEND

TNFRSF8

tumor necrosis factor receptor superfamily, member 8

Synonyms: CD30 D1S166E Ki-1
UniProtKB ID: P28908, B1AN79, Q6P4D9
Gene ID:
Human(943) Summary: The protein encoded by this gene is a member of the TNF-receptor superfamily. This receptor is expressed by activated, but not by resting, T and B cells. TRAF2 and TRAF5 can interact with this receptor, and mediate the signal transduction that leads to the activation of NF-kappaB. This receptor is a positive regulator of apoptosis, and also has been shown to limit the proliferative potential of autoreactive CD8 effector T cells and protect the body against autoimmunity. Two alternatively spliced transcript variants of this gene encoding distinct isoforms have been reported. [provided by RefSeq, Jul 2008]
Mouse(21941) tumor necrosis factor receptor superfamily, member 8
Rat(25069) tumor necrosis factor receptor superfamily, member 8
cow(614780) tumor necrosis factor receptor superfamily, member 8
sheep(101111039) tumor necrosis factor receptor superfamily, member 8
domestic guinea pig(100723547) tumor necrosis factor receptor superfamily, member 8
naked mole-rat(101704995) tumor necrosis factor receptor superfamily, member 8
chicken(395090) tumor necrosis factor receptor superfamily, member 8
dog(487438) tumor necrosis factor receptor superfamily, member 8
domestic cat(101101575) tumor necrosis factor receptor superfamily, member 8
Horse(100055885) tumor necrosis factor receptor superfamily, member 8
103 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
C3104 Anti-CD30 antibody produced in goat affinity isolated antibody, lyophilized powder mouse
ELISA, western blot pricing
C5979 Anti-CD30 antibody produced in goat affinity isolated antibody, lyophilized powder human
ELISA, western blot pricing
GW21411A Anti-TNFRSF8 antibody produced in chicken affinity isolated antibody, buffered aqueous solution human
western blot pricing
HPA032081 Anti-TNFRSF8 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
HPA032082 Anti-TNFRSF8 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
SAB4700148 Monoclonal Anti-CD30 antibody produced in mouse clone MEM-268, purified immunoglobulin, buffered aqueous solution human
flow cytometry pricing
SAB4700149 Monoclonal Anti-CD30-APC antibody produced in mouse clone MEM-268, purified immunoglobulin, buffered aqueous solution human
flow cytometry pricing
SAB4700150 Monoclonal Anti-CD30-FITC antibody produced in mouse clone MEM-268, purified immunoglobulin, buffered aqueous solution human
flow cytometry pricing
SAB4700151 Monoclonal Anti-CD30-PE antibody produced in mouse clone MEM-268, purified immunoglobulin, buffered aqueous solution human
flow cytometry pricing
WH0000943M1 Monoclonal Anti-TNFRSF8 antibody produced in mouse clone 3B9, purified immunoglobulin, buffered aqueous solution human
ELISA pricing
SAB1403648 Monoclonal Anti-TNFRSF8 antibody produced in mouse clone 2E2, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001243 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001243 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001243 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009401 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009401 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009401 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU150281 MISSION® esiRNA esiRNA human TNFRSF8 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001243 Rosetta Predictions human pricing
NM_152942 Rosetta Predictions human pricing
NM_019135 Rosetta Predictions rat pricing
NM_009401 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001243 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00046955 predicted 1574
2 SASI_Hs01_00046956 predicted 1599
3 SASI_Hs01_00046957 predicted 1744
4 SASI_Hs01_00046958 predicted 481
5 SASI_Hs01_00046959 predicted 607
6 SASI_Hs01_00046960 predicted 1505
7 SASI_Hs02_00331420 predicted 400
8 SASI_Hs01_00046961 predicted 1476
9 SASI_Hs01_00046962 predicted 1070
10 SASI_Hs01_00046963 predicted 552
11 SASI_Hs01_00046964 predicted 2101
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152942 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00013880 predicted 968
2 SASI_Hs01_00013881 predicted 768
3 SASI_Hs02_00366931 predicted 938
4 SASI_Hs01_00013882 predicted 620
5 SASI_Hs01_00013883 predicted 419
6 SASI_Hs01_00013884 predicted 1495
7 SASI_Hs01_00013885 predicted 1884
8 SASI_Hs01_00013886 predicted 2252
9 SASI_Hs01_00013887 predicted 1891
10 SASI_Hs01_00013888 predicted 2011
11 SASI_Hs01_00013889 predicted 1980
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019135 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00096734 predicted 1020
2 SASI_Rn01_00096735 predicted 1060
3 SASI_Rn01_00096736 predicted 1611
4 SASI_Rn01_00096737 predicted 1414
5 SASI_Rn01_00096738 predicted 876
6 SASI_Rn01_00096739 predicted 735
7 SASI_Rn02_00261884 predicted 1025
8 SASI_Rn01_00096740 predicted 1623
9 SASI_Rn01_00096741 predicted 1603
10 SASI_Rn01_00096742 predicted 1579
11 SASI_Rn01_00096733 predicted 790
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009401 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00102895 predicted 1014
2 SASI_Mm01_00102896 predicted 1101
3 SASI_Mm02_00316032 predicted 1134
4 SASI_Mm02_00316033 predicted 1063
5 SASI_Mm01_00102898 predicted 266
6 SASI_Mm01_00102899 predicted 439
7 SASI_Mm01_00102900 predicted 1278
8 SASI_Mm01_00102902 predicted 1340
9 SASI_Mm01_00102903 predicted 1296
10 SASI_Mm01_00102904 predicted 353
11 SASI_Mm01_00102897 predicted 979
12 SASI_Mm01_00102901 predicted 1073
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001243
TNFRSF8 MISSION shRNA Bacterial Glycerol Stock
tumor necrosis factor receptor superfamily, member 8
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000058833    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001243.2-1514s1c1
Sequence:CCGGCCAAGCTAGAGCTTGTGGATTCTCGAGAATCCACAAGCTCTAGCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058834    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001243.2-1749s1c1
Sequence:CCGGCACCAATAACAAGATTGAGAACTCGAGTTCTCAATCTTGTTATTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058835    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001243.2-474s1c1
Sequence:CCGGCGTGACTTGTTCTCGAGATGACTCGAGTCATCTCGAGAACAAGTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058836    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001243.2-1377s1c1
Sequence:CCGGGCCAGTGCTCTTCTGGGTGATCTCGAGATCACCCAGAAGAGCACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058837    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001243.2-292s1c1
Sequence:CCGGCCCTTCGAGGACACCTGTCATCTCGAGATGACAGGTGTCCTCGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436602    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001243.3-1779s21c1
Sequence:CCGGCATGAAGGCTGACACCGTGATCTCGAGATCACGGTGTCAGCCTTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421794    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001243.3-1594s21c1
Sequence:CCGGGCGGAAGAGCGAGGGTTAATGCTCGAGCATTAACCCTCGCTCTTCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436223    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001243.3-1068s21c1
Sequence:CCGGATGTCGACCTGGCATGATCTGCTCGAGCAGATCATGCCAGGTCGACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001243
TNFRSF8 MISSION shRNA shRNA Plasmid DNA
tumor necrosis factor receptor superfamily, member 8
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000058833    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001243.2-1514s1c1
Sequence:CCGGCCAAGCTAGAGCTTGTGGATTCTCGAGAATCCACAAGCTCTAGCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058834    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001243.2-1749s1c1
Sequence:CCGGCACCAATAACAAGATTGAGAACTCGAGTTCTCAATCTTGTTATTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058835    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001243.2-474s1c1
Sequence:CCGGCGTGACTTGTTCTCGAGATGACTCGAGTCATCTCGAGAACAAGTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058836    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001243.2-1377s1c1
Sequence:CCGGGCCAGTGCTCTTCTGGGTGATCTCGAGATCACCCAGAAGAGCACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058837    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001243.2-292s1c1
Sequence:CCGGCCCTTCGAGGACACCTGTCATCTCGAGATGACAGGTGTCCTCGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436602    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001243.3-1779s21c1
Sequence:CCGGCATGAAGGCTGACACCGTGATCTCGAGATCACGGTGTCAGCCTTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421794    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001243.3-1594s21c1
Sequence:CCGGGCGGAAGAGCGAGGGTTAATGCTCGAGCATTAACCCTCGCTCTTCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436223    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001243.3-1068s21c1
Sequence:CCGGATGTCGACCTGGCATGATCTGCTCGAGCAGATCATGCCAGGTCGACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001243
TNFRSF8 MISSION shRNA Lentiviral Transduction Particles
tumor necrosis factor receptor superfamily, member 8
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000058833    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001243.2-1514s1c1
Sequence:CCGGCCAAGCTAGAGCTTGTGGATTCTCGAGAATCCACAAGCTCTAGCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058834    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001243.2-1749s1c1
Sequence:CCGGCACCAATAACAAGATTGAGAACTCGAGTTCTCAATCTTGTTATTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058835    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001243.2-474s1c1
Sequence:CCGGCGTGACTTGTTCTCGAGATGACTCGAGTCATCTCGAGAACAAGTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058836    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001243.2-1377s1c1
Sequence:CCGGGCCAGTGCTCTTCTGGGTGATCTCGAGATCACCCAGAAGAGCACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058837    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001243.2-292s1c1
Sequence:CCGGCCCTTCGAGGACACCTGTCATCTCGAGATGACAGGTGTCCTCGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436602    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001243.3-1779s21c1
Sequence:CCGGCATGAAGGCTGACACCGTGATCTCGAGATCACGGTGTCAGCCTTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421794    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001243.3-1594s21c1
Sequence:CCGGGCGGAAGAGCGAGGGTTAATGCTCGAGCATTAACCCTCGCTCTTCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436223    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001243.3-1068s21c1
Sequence:CCGGATGTCGACCTGGCATGATCTGCTCGAGCAGATCATGCCAGGTCGACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009401
TNFRSF8 MISSION shRNA Bacterial Glycerol Stock
tumor necrosis factor receptor superfamily, member 8
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000066483    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009401.1-274s1c1
Sequence:CCGGCCTGACTACTACGTCAATGAACTCGAGTTCATTGACGTAGTAGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066484    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009401.1-1420s1c1
Sequence:CCGGGCTGAACTAGAAGTGGACCATCTCGAGATGGTCCACTTCTAGTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066485    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009401.1-1017s1c1
Sequence:CCGGGCAGAAGTTTCACCTGGACTACTCGAGTAGTCCAGGTGAAACTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066486    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009401.1-550s1c1
Sequence:CCGGCGCAAGACACTTACTAGCCATCTCGAGATGGCTAGTAAGTGTCTTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066487    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009401.1-667s1c1
Sequence:CCGGGCTACTGAGTTGGTGAAGGTTCTCGAGAACCTTCACCAACTCAGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009401
TNFRSF8 MISSION shRNA shRNA Plasmid DNA
tumor necrosis factor receptor superfamily, member 8
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000066483    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009401.1-274s1c1
Sequence:CCGGCCTGACTACTACGTCAATGAACTCGAGTTCATTGACGTAGTAGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066484    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009401.1-1420s1c1
Sequence:CCGGGCTGAACTAGAAGTGGACCATCTCGAGATGGTCCACTTCTAGTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066485    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009401.1-1017s1c1
Sequence:CCGGGCAGAAGTTTCACCTGGACTACTCGAGTAGTCCAGGTGAAACTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066486    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009401.1-550s1c1
Sequence:CCGGCGCAAGACACTTACTAGCCATCTCGAGATGGCTAGTAAGTGTCTTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066487    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009401.1-667s1c1
Sequence:CCGGGCTACTGAGTTGGTGAAGGTTCTCGAGAACCTTCACCAACTCAGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009401
TNFRSF8 MISSION shRNA Lentiviral Transduction Particles
tumor necrosis factor receptor superfamily, member 8
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000066483    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009401.1-274s1c1
Sequence:CCGGCCTGACTACTACGTCAATGAACTCGAGTTCATTGACGTAGTAGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066484    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009401.1-1420s1c1
Sequence:CCGGGCTGAACTAGAAGTGGACCATCTCGAGATGGTCCACTTCTAGTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066485    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009401.1-1017s1c1
Sequence:CCGGGCAGAAGTTTCACCTGGACTACTCGAGTAGTCCAGGTGAAACTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066486    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009401.1-550s1c1
Sequence:CCGGCGCAAGACACTTACTAGCCATCTCGAGATGGCTAGTAAGTGTCTTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066487    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009401.1-667s1c1
Sequence:CCGGGCTACTGAGTTGGTGAAGGTTCTCGAGAACCTTCACCAACTCAGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks