EMAIL THIS PAGE TO A FRIEND

TNFRSF9

tumor necrosis factor receptor superfamily, member 9

Synonyms: 4-1BB CD137 CDw137 ILA
UniProtKB ID: Q07011
Gene ID:
Human(3604) Summary: The protein encoded by this gene is a member of the TNF-receptor superfamily. This receptor contributes to the clonal expansion, survival, and development of T cells. It can also induce proliferation in peripheral monocytes, enhance T cell apoptosis induced by TCR/CD3 triggered activation, and regulate CD28 co-stimulation to promote Th1 cell responses. The expression of this receptor is induced by lymphocyte activation. TRAF adaptor proteins have been shown to bind to this receptor and transduce the signals leading to activation of NF-kappaB. [provided by RefSeq, Jul 2008]
Mouse(21942) tumor necrosis factor receptor superfamily, member 9
Rat(500590) tumor necrosis factor receptor superfamily, member 9
chicken(419365) tumor necrosis factor receptor superfamily, member 9
domestic cat(101096582) tumor necrosis factor receptor superfamily, member 9
dog(608274) tumor necrosis factor receptor superfamily, member 9
naked mole-rat(101708619) tumor necrosis factor receptor superfamily, member 9
domestic guinea pig(100730923) tumor necrosis factor receptor superfamily, member 9
cow(520341) tumor necrosis factor receptor superfamily, member 9
sheep(101119742) tumor necrosis factor receptor superfamily, member 9
104 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001561 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001561 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001561 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011612 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011612 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011612 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001561 Rosetta Predictions human pricing
NM_001025773 Rosetta Predictions rat pricing
NM_001077508 Rosetta Predictions mouse pricing
NM_001077509 Rosetta Predictions mouse pricing
NM_011612 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001561 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00196336 predicted 679
2 SASI_Hs01_00196337 predicted 775
3 SASI_Hs01_00196338 predicted 308
4 SASI_Hs01_00196339 predicted 670
5 SASI_Hs01_00196340 predicted 549
6 SASI_Hs01_00196341 predicted 468
7 SASI_Hs01_00196342 predicted 424
8 SASI_Hs01_00196343 predicted 316
9 SASI_Hs01_00196344 predicted 428
10 SASI_Hs01_00196345 predicted 531
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025773 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00103300 predicted 426
2 SASI_Rn01_00103301 predicted 843
3 SASI_Rn01_00103302 predicted 1086
4 SASI_Rn02_00203453 predicted 655
5 SASI_Rn01_00103303 predicted 1028
6 SASI_Rn01_00103304 predicted 629
7 SASI_Rn02_00203454 predicted 1157
8 SASI_Rn01_00103306 predicted 683
9 SASI_Rn01_00103307 predicted 1117
10 SASI_Rn01_00103308 predicted 629
11 SASI_Rn01_00103305 predicted 940
12 SASI_Rn01_00103309 predicted 719
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001077508 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00292722 predicted 330
2 SASI_Mm02_00292723 predicted 374
3 SASI_Mm02_00292724 predicted 327
4 SASI_Mm02_00292725 predicted 321
5 SASI_Mm02_00292726 predicted 317
6 SASI_Mm02_00292727 predicted 319
7 SASI_Mm02_00292728 predicted 324
8 SASI_Mm02_00292729 predicted 479
9 SASI_Mm02_00292730 predicted 893
10 SASI_Mm02_00292731 predicted 143
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001077509 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00292732 predicted 456
2 SASI_Mm02_00292733 predicted 390
3 SASI_Mm02_00292734 predicted 519
4 SASI_Mm02_00292735 predicted 738
5 SASI_Mm02_00292736 predicted 591
6 SASI_Mm02_00292737 predicted 394
7 SASI_Mm02_00292738 predicted 765
8 SASI_Mm02_00292739 predicted 307
9 SASI_Mm02_00292740 predicted 733
10 SASI_Mm02_00292741 predicted 613
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011612 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00321037 predicted 328
2 SASI_Mm02_00321038 predicted 380
3 SASI_Mm01_00056934 predicted 331
4 SASI_Mm02_00321039 predicted 314
5 SASI_Mm02_00321040 predicted 315
6 SASI_Mm02_00321041 predicted 326
7 SASI_Mm02_00321042 predicted 330
8 SASI_Mm02_00321043 predicted 780
9 SASI_Mm02_00321044 predicted 144
10 SASI_Mm02_00321045 predicted 898
11 SASI_Mm01_00056927 predicted 503
12 SASI_Mm01_00056928 predicted 427
13 SASI_Mm01_00056929 predicted 560
14 SASI_Mm01_00056930 predicted 776
15 SASI_Mm01_00056931 predicted 430
16 SASI_Mm01_00056932 predicted 222
17 SASI_Mm01_00056933 predicted 809
18 SASI_Mm01_00056935 predicted 779
19 SASI_Mm01_00056936 predicted 657
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001561
TNFRSF9 MISSION shRNA Bacterial Glycerol Stock
tumor necrosis factor receptor superfamily, member 9
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000436133    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001561.4-946s21c1
Sequence:CCGGATATGAGTCATCCGCTATCACCTCGAGGTGATAGCGGATGACTCATATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414528    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001561.4-263s21c1
Sequence:CCGGCAGTCCCTGTCCTCCAAATAGCTCGAGCTATTTGGAGGACAGGGACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433667    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001561.4-979s21c1
Sequence:CCGGCAAGAACACCATCCTACATAACTCGAGTTATGTAGGATGGTGTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058658    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001561.4-681s1c1
Sequence:CCGGCCGCAGATCATCTCCTTCTTTCTCGAGAAAGAAGGAGATGATCTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058662    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001561.4-749s1c1
Sequence:CCGGGCTCCGTTTCTCTGTTGTTAACTCGAGTTAACAACAGAGAAACGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058661    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001561.4-225s1c1
Sequence:CCGGGCTGGTACATTCTGTGATAATCTCGAGATTATCACAGAATGTACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058659    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001561.4-775s1c1
Sequence:CCGGGCAGAAAGAAACTCCTGTATACTCGAGTATACAGGAGTTTCTTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058660    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001561.4-322s1c1
Sequence:CCGGGCAGGCAGTGTAAAGGTGTTTCTCGAGAAACACCTTTACACTGCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001561
TNFRSF9 MISSION shRNA shRNA Plasmid DNA
tumor necrosis factor receptor superfamily, member 9
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000436133    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001561.4-946s21c1
Sequence:CCGGATATGAGTCATCCGCTATCACCTCGAGGTGATAGCGGATGACTCATATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414528    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001561.4-263s21c1
Sequence:CCGGCAGTCCCTGTCCTCCAAATAGCTCGAGCTATTTGGAGGACAGGGACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433667    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001561.4-979s21c1
Sequence:CCGGCAAGAACACCATCCTACATAACTCGAGTTATGTAGGATGGTGTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058658    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001561.4-681s1c1
Sequence:CCGGCCGCAGATCATCTCCTTCTTTCTCGAGAAAGAAGGAGATGATCTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058662    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001561.4-749s1c1
Sequence:CCGGGCTCCGTTTCTCTGTTGTTAACTCGAGTTAACAACAGAGAAACGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058661    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001561.4-225s1c1
Sequence:CCGGGCTGGTACATTCTGTGATAATCTCGAGATTATCACAGAATGTACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058659    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001561.4-775s1c1
Sequence:CCGGGCAGAAAGAAACTCCTGTATACTCGAGTATACAGGAGTTTCTTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058660    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001561.4-322s1c1
Sequence:CCGGGCAGGCAGTGTAAAGGTGTTTCTCGAGAAACACCTTTACACTGCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001561
TNFRSF9 MISSION shRNA Lentiviral Transduction Particles
tumor necrosis factor receptor superfamily, member 9
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000436133    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001561.4-946s21c1
Sequence:CCGGATATGAGTCATCCGCTATCACCTCGAGGTGATAGCGGATGACTCATATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414528    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001561.4-263s21c1
Sequence:CCGGCAGTCCCTGTCCTCCAAATAGCTCGAGCTATTTGGAGGACAGGGACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433667    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001561.4-979s21c1
Sequence:CCGGCAAGAACACCATCCTACATAACTCGAGTTATGTAGGATGGTGTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058658    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001561.4-681s1c1
Sequence:CCGGCCGCAGATCATCTCCTTCTTTCTCGAGAAAGAAGGAGATGATCTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058662    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001561.4-749s1c1
Sequence:CCGGGCTCCGTTTCTCTGTTGTTAACTCGAGTTAACAACAGAGAAACGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058661    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001561.4-225s1c1
Sequence:CCGGGCTGGTACATTCTGTGATAATCTCGAGATTATCACAGAATGTACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058659    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001561.4-775s1c1
Sequence:CCGGGCAGAAAGAAACTCCTGTATACTCGAGTATACAGGAGTTTCTTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058660    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001561.4-322s1c1
Sequence:CCGGGCAGGCAGTGTAAAGGTGTTTCTCGAGAAACACCTTTACACTGCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011612
VALIDATED
TNFRSF9 MISSION shRNA Bacterial Glycerol Stock
tumor necrosis factor receptor superfamily, member 9
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000313481    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011612.2-790s21c1
Sequence:CCGGACATATTCAAGCAACCATTTACTCGAGTAAATGGTTGCTTGAATATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000312306    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011612.2-484s21c1
Sequence:CCGGCCTGTAGCTTGGGAACATTTACTCGAGTAAATGTTCCCAAGCTACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000313480    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011612.2-724s21c1
Sequence:CCGGTGCTGGCCCTGATCTTCATTACTCGAGTAATGAAGATCAGGGCCAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000349439    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011612.2-200s21c1
Sequence:CCGGCGTGCAGAACTCCTGTGATAACTCGAGTTATCACAGGAGTTCTGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000313479    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011612.2-1389s21c1
Sequence:CCGGAGGACTGTGGGAAGATCAATTCTCGAGAATTGATCTTCCCACAGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066538    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011612.1-1350s1c1
Sequence:CCGGCCCTTCTAGTTAATGATCTAACTCGAGTTAGATCATTAACTAGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066542    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011612.1-748s1c1
Sequence:CCGGGATCTTCATTACTCTCCTGTTCTCGAGAACAGGAGAGTAATGAAGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066541    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011612.1-498s1c1
Sequence:CCGGCCTGTAGCTTGGGAACATTTACTCGAGTAAATGTTCCCAAGCTACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066539    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011612.1-802s1c1
Sequence:CCGGCCACATATTCAAGCAACCATTCTCGAGAATGGTTGCTTGAATATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066540    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011612.1-214s1c1
Sequence:CCGGCGTGCAGAACTCCTGTGATAACTCGAGTTATCACAGGAGTTCTGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011612
VALIDATED
TNFRSF9 MISSION shRNA shRNA Plasmid DNA
tumor necrosis factor receptor superfamily, member 9
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000313481    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011612.2-790s21c1
Sequence:CCGGACATATTCAAGCAACCATTTACTCGAGTAAATGGTTGCTTGAATATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000312306    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011612.2-484s21c1
Sequence:CCGGCCTGTAGCTTGGGAACATTTACTCGAGTAAATGTTCCCAAGCTACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000313480    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011612.2-724s21c1
Sequence:CCGGTGCTGGCCCTGATCTTCATTACTCGAGTAATGAAGATCAGGGCCAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000349439    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011612.2-200s21c1
Sequence:CCGGCGTGCAGAACTCCTGTGATAACTCGAGTTATCACAGGAGTTCTGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000313479    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011612.2-1389s21c1
Sequence:CCGGAGGACTGTGGGAAGATCAATTCTCGAGAATTGATCTTCCCACAGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066538    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011612.1-1350s1c1
Sequence:CCGGCCCTTCTAGTTAATGATCTAACTCGAGTTAGATCATTAACTAGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066542    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011612.1-748s1c1
Sequence:CCGGGATCTTCATTACTCTCCTGTTCTCGAGAACAGGAGAGTAATGAAGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066541    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011612.1-498s1c1
Sequence:CCGGCCTGTAGCTTGGGAACATTTACTCGAGTAAATGTTCCCAAGCTACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066539    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011612.1-802s1c1
Sequence:CCGGCCACATATTCAAGCAACCATTCTCGAGAATGGTTGCTTGAATATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066540    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011612.1-214s1c1
Sequence:CCGGCGTGCAGAACTCCTGTGATAACTCGAGTTATCACAGGAGTTCTGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011612
VALIDATED
TNFRSF9 MISSION shRNA Lentiviral Transduction Particles
tumor necrosis factor receptor superfamily, member 9
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000313481    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011612.2-790s21c1
Sequence:CCGGACATATTCAAGCAACCATTTACTCGAGTAAATGGTTGCTTGAATATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000312306    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011612.2-484s21c1
Sequence:CCGGCCTGTAGCTTGGGAACATTTACTCGAGTAAATGTTCCCAAGCTACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000313480    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011612.2-724s21c1
Sequence:CCGGTGCTGGCCCTGATCTTCATTACTCGAGTAATGAAGATCAGGGCCAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000349439    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011612.2-200s21c1
Sequence:CCGGCGTGCAGAACTCCTGTGATAACTCGAGTTATCACAGGAGTTCTGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000313479    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011612.2-1389s21c1
Sequence:CCGGAGGACTGTGGGAAGATCAATTCTCGAGAATTGATCTTCCCACAGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066538    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011612.1-1350s1c1
Sequence:CCGGCCCTTCTAGTTAATGATCTAACTCGAGTTAGATCATTAACTAGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066542    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011612.1-748s1c1
Sequence:CCGGGATCTTCATTACTCTCCTGTTCTCGAGAACAGGAGAGTAATGAAGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066541    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011612.1-498s1c1
Sequence:CCGGCCTGTAGCTTGGGAACATTTACTCGAGTAAATGTTCCCAAGCTACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066539    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011612.1-802s1c1
Sequence:CCGGCCACATATTCAAGCAACCATTCTCGAGAATGGTTGCTTGAATATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066540    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011612.1-214s1c1
Sequence:CCGGCGTGCAGAACTCCTGTGATAACTCGAGTTATCACAGGAGTTCTGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks