EMAIL THIS PAGE TO A FRIEND

TNFSF10

tumor necrosis factor (ligand) superfamily, member 10

Synonyms: APO2L Apo-2L CD253 TL2 TRAIL
UniProtKB ID: P50591, A1Y9B3
Gene ID:
Human(8743) Summary: The protein encoded by this gene is a cytokine that belongs to the tumor necrosis factor (TNF) ligand family. This protein preferentially induces apoptosis in transformed and tumor cells, but does not appear to kill normal cells although it is expressed at a significant level in most normal tissues. This protein binds to several members of TNF receptor superfamily including TNFRSF10A/TRAILR1, TNFRSF10B/TRAILR2, TNFRSF10C/TRAILR3, TNFRSF10D/TRAILR4, and possibly also to TNFRSF11B/OPG. The activity of this protein may be modulated by binding to the decoy receptors TNFRSF10C/TRAILR3, TNFRSF10D/TRAILR4, and TNFRSF11B/OPG that cannot induce apoptosis. The binding of this protein to its receptors has been shown to trigger the activation of MAPK8/JNK, caspase 8, and caspase 3. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2010]
Mouse(22035) tumor necrosis factor (ligand) superfamily, member 10
Rat(246775) tumor necrosis factor (ligand) superfamily, member 10
Zebrafish(436866) tumor necrosis factor (ligand) superfamily, member 10
domestic cat(100174789) tumor necrosis factor (ligand) superfamily, member 10
domestic cat(101083289) tumor necrosis factor (ligand) superfamily, member 10
dog(100174780) tumor necrosis factor (ligand) superfamily, member 10
chicken(378894) tumor necrosis factor (ligand) superfamily, member 10
cow(507215) tumor necrosis factor (ligand) superfamily, member 10
sheep(101114153) tumor necrosis factor (ligand) superfamily, member 10
domestic guinea pig(100734497) tumor necrosis factor (ligand) superfamily, member 10
naked mole-rat(101702439) tumor necrosis factor (ligand) superfamily, member 10
Gene Class: Apoptosis, Cytokines_and_Chemokines
122 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003810 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003810 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003810 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009425 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009425 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009425 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003810 Rosetta Predictions human pricing
NM_145681 Rosetta Predictions rat pricing
NM_009425 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003810 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00046158 predicted 781
2 SASI_Hs01_00046159 predicted 450
3 SASI_Hs01_00046160 predicted 606
4 SASI_Hs01_00046161 predicted 371
5 SASI_Hs01_00046162 predicted 445
6 SASI_Hs01_00046163 predicted 737
7 SASI_Hs01_00046164 predicted 743
8 SASI_Hs01_00046165 predicted 579
9 SASI_Hs01_00046166 predicted 586
10 SASI_Hs01_00046167 predicted 498
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145681 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00120385 predicted 378
2 SASI_Rn01_00120387 predicted 261
3 SASI_Rn01_00120388 predicted 236
4 SASI_Rn01_00120389 predicted 638
5 SASI_Rn02_00268735 predicted 412
6 SASI_Rn01_00120390 predicted 414
7 SASI_Rn01_00120391 predicted 584
8 SASI_Rn01_00120392 predicted 294
9 SASI_Rn01_00120393 predicted 574
10 SASI_Rn02_00268736 predicted 381
11 SASI_Rn01_00120386 predicted 498
12 SASI_Rn01_00120394 predicted 613
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009425 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00316092 predicted 464
2 SASI_Mm02_00316093 predicted 283
3 SASI_Mm02_00316094 predicted 325
4 SASI_Mm02_00316095 predicted 350
5 SASI_Mm02_00316096 predicted 441
6 SASI_Mm02_00316097 predicted 547
7 SASI_Mm02_00316098 predicted 1095
8 SASI_Mm02_00316099 predicted 241
9 SASI_Mm02_00316100 predicted 353
10 SASI_Mm02_00316101 predicted 622
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003810
VALIDATED
TNFSF10 MISSION shRNA Bacterial Glycerol Stock
tumor necrosis factor (ligand) superfamily, member 10
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000005926    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003810.2-701s1c1
Sequence:CCGGCGACAAACAAATGGTCCAATACTCGAGTATTGGACCATTTGTTTGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005928    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_003810.2-873s1c1
Sequence:CCGGGTAACAAATGAGCACTTGATACTCGAGTATCAAGTGCTCATTTGTTACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005924    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_003810.2-967s1c1
Sequence:CCGGCCTCAAAGTGACTATTCAGTTCTCGAGAACTGAATAGTCACTTTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005927    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_003810.2-391s1c1
Sequence:CCGGCCATTTCTACAGTTCAAGAAACTCGAGTTTCTTGAACTGTAGAAATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000368329    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003810.2-1377s21c1
Sequence:CCGGGAGAGAAGAGGCACCACTAAACTCGAGTTTAGTGGTGCCTCTTCTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364116    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003810.2-702s21c1
Sequence:CCGGGACAAACAAATGGTCCAATATCTCGAGATATTGGACCATTTGTTTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364115    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003810.2-774s21c1
Sequence:CCGGAGAAATAGTTGTTGGTCTAAACTCGAGTTTAGACCAACAACTATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364107    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003810.2-738s21c1
Sequence:CCGGAGTTATCCTGACCCTATATTGCTCGAGCAATATAGGGTCAGGATAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003810
VALIDATED
TNFSF10 MISSION shRNA shRNA Plasmid DNA
tumor necrosis factor (ligand) superfamily, member 10
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000005926    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003810.2-701s1c1
Sequence:CCGGCGACAAACAAATGGTCCAATACTCGAGTATTGGACCATTTGTTTGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005928    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_003810.2-873s1c1
Sequence:CCGGGTAACAAATGAGCACTTGATACTCGAGTATCAAGTGCTCATTTGTTACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005924    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_003810.2-967s1c1
Sequence:CCGGCCTCAAAGTGACTATTCAGTTCTCGAGAACTGAATAGTCACTTTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005927    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_003810.2-391s1c1
Sequence:CCGGCCATTTCTACAGTTCAAGAAACTCGAGTTTCTTGAACTGTAGAAATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000368329    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003810.2-1377s21c1
Sequence:CCGGGAGAGAAGAGGCACCACTAAACTCGAGTTTAGTGGTGCCTCTTCTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364116    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003810.2-702s21c1
Sequence:CCGGGACAAACAAATGGTCCAATATCTCGAGATATTGGACCATTTGTTTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364115    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003810.2-774s21c1
Sequence:CCGGAGAAATAGTTGTTGGTCTAAACTCGAGTTTAGACCAACAACTATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364107    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003810.2-738s21c1
Sequence:CCGGAGTTATCCTGACCCTATATTGCTCGAGCAATATAGGGTCAGGATAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003810
VALIDATED
TNFSF10 MISSION shRNA Lentiviral Transduction Particles
tumor necrosis factor (ligand) superfamily, member 10
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000005926    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003810.2-701s1c1
Sequence:CCGGCGACAAACAAATGGTCCAATACTCGAGTATTGGACCATTTGTTTGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005928    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_003810.2-873s1c1
Sequence:CCGGGTAACAAATGAGCACTTGATACTCGAGTATCAAGTGCTCATTTGTTACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005924    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_003810.2-967s1c1
Sequence:CCGGCCTCAAAGTGACTATTCAGTTCTCGAGAACTGAATAGTCACTTTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005927    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_003810.2-391s1c1
Sequence:CCGGCCATTTCTACAGTTCAAGAAACTCGAGTTTCTTGAACTGTAGAAATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000368329    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003810.2-1377s21c1
Sequence:CCGGGAGAGAAGAGGCACCACTAAACTCGAGTTTAGTGGTGCCTCTTCTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364116    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003810.2-702s21c1
Sequence:CCGGGACAAACAAATGGTCCAATATCTCGAGATATTGGACCATTTGTTTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364115    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003810.2-774s21c1
Sequence:CCGGAGAAATAGTTGTTGGTCTAAACTCGAGTTTAGACCAACAACTATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364107    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003810.2-738s21c1
Sequence:CCGGAGTTATCCTGACCCTATATTGCTCGAGCAATATAGGGTCAGGATAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009425
TNFSF10 MISSION shRNA Bacterial Glycerol Stock
tumor necrosis factor (ligand) superfamily, member 10
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000066234    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009425.1-449s1c1
Sequence:CCGGCGGAGAAGCAACTCAGCTTTACTCGAGTAAAGCTGAGTTGCTTCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066237    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009425.1-796s1c1
Sequence:CCGGCTCCATCTATCAGGGAGGATTCTCGAGAATCCTCCCTGATAGATGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066235    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009425.1-649s1c1
Sequence:CCGGCGCTTCCAAGATGGTCTCAAACTCGAGTTTGAGACCATCTTGGAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066236    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009425.1-316s1c1
Sequence:CCGGGCTCATTGAAGAGGTGACTTTCTCGAGAAAGTCACCTCTTCAATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000362539    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009425.2-363s21c1
Sequence:CCGGGAACCTTTCAGGACACCATTTCTCGAGAAATGGTGTCCTGAAAGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000362538    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009425.2-1190s21c1
Sequence:CCGGGATCTACCTGGTATCAGTTTGCTCGAGCAAACTGATACCAGGTAGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000362602    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009425.2-551s21c1
Sequence:CCGGTCTCGGAAAGGGCATTCATTTCTCGAGAAATGAATGCCCTTTCCGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009425
TNFSF10 MISSION shRNA shRNA Plasmid DNA
tumor necrosis factor (ligand) superfamily, member 10
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000066234    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009425.1-449s1c1
Sequence:CCGGCGGAGAAGCAACTCAGCTTTACTCGAGTAAAGCTGAGTTGCTTCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066237    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009425.1-796s1c1
Sequence:CCGGCTCCATCTATCAGGGAGGATTCTCGAGAATCCTCCCTGATAGATGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066235    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009425.1-649s1c1
Sequence:CCGGCGCTTCCAAGATGGTCTCAAACTCGAGTTTGAGACCATCTTGGAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066236    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009425.1-316s1c1
Sequence:CCGGGCTCATTGAAGAGGTGACTTTCTCGAGAAAGTCACCTCTTCAATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000362539    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009425.2-363s21c1
Sequence:CCGGGAACCTTTCAGGACACCATTTCTCGAGAAATGGTGTCCTGAAAGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000362538    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009425.2-1190s21c1
Sequence:CCGGGATCTACCTGGTATCAGTTTGCTCGAGCAAACTGATACCAGGTAGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000362602    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009425.2-551s21c1
Sequence:CCGGTCTCGGAAAGGGCATTCATTTCTCGAGAAATGAATGCCCTTTCCGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009425
TNFSF10 MISSION shRNA Lentiviral Transduction Particles
tumor necrosis factor (ligand) superfamily, member 10
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000066234    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009425.1-449s1c1
Sequence:CCGGCGGAGAAGCAACTCAGCTTTACTCGAGTAAAGCTGAGTTGCTTCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066237    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009425.1-796s1c1
Sequence:CCGGCTCCATCTATCAGGGAGGATTCTCGAGAATCCTCCCTGATAGATGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066235    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009425.1-649s1c1
Sequence:CCGGCGCTTCCAAGATGGTCTCAAACTCGAGTTTGAGACCATCTTGGAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066236    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009425.1-316s1c1
Sequence:CCGGGCTCATTGAAGAGGTGACTTTCTCGAGAAAGTCACCTCTTCAATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000362539    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009425.2-363s21c1
Sequence:CCGGGAACCTTTCAGGACACCATTTCTCGAGAAATGGTGTCCTGAAAGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000362538    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009425.2-1190s21c1
Sequence:CCGGGATCTACCTGGTATCAGTTTGCTCGAGCAAACTGATACCAGGTAGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000362602    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009425.2-551s21c1
Sequence:CCGGTCTCGGAAAGGGCATTCATTTCTCGAGAAATGAATGCCCTTTCCGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks