EMAIL THIS PAGE TO A FRIEND

TNFSF11

tumor necrosis factor (ligand) superfamily, member 11

Synonyms: CD254 ODF OPGL OPTB2 RANKL TRANCE hRANKL2 sOdf
UniProtKB ID: O14788, O14723, Q96Q17, Q9P2Q3
Gene ID:
Human(8600) Summary: This gene encodes a member of the tumor necrosis factor (TNF) cytokine family which is a ligand for osteoprotegerin and functions as a key factor for osteoclast differentiation and activation. This protein was shown to be a dentritic cell survival factor and is involved in the regulation of T cell-dependent immune response. T cell activation was reported to induce expression of this gene and lead to an increase of osteoclastogenesis and bone loss. This protein was shown to activate antiapoptotic kinase AKT/PKB through a signaling complex involving SRC kinase and tumor necrosis factor receptor-associated factor (TRAF) 6, which indicated this protein may have a role in the regulation of cell apoptosis. Targeted disruption of the related gene in mice led to severe osteopetrosis and a lack of osteoclasts. The deficient mice exhibited defects in early differentiation of T and B lymphocytes, and failed to form lobulo-alveolar mammary structures during pregnancy. Two alternatively spliced transcript variants have been found. [provided by RefSeq, Jul 2008]
Mouse(21943) tumor necrosis factor (ligand) superfamily, member 11
Rat(117516) tumor necrosis factor (ligand) superfamily, member 11
Zebrafish(100331628) tumor necrosis factor (ligand) superfamily, member 11
dog(609418) tumor necrosis factor (ligand) superfamily, member 11
chicken(428067) tumor necrosis factor (ligand) superfamily, member 11
naked mole-rat(101696350) tumor necrosis factor (ligand) superfamily, member 11
domestic guinea pig(100713226) tumor necrosis factor (ligand) superfamily, member 11
cow(513836) tumor necrosis factor (ligand) superfamily, member 11
Gene Class: Cytokines_and_Chemokines
169 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_033012 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_033012 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_033012 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011613 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011613 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011613 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU061701 MISSION® esiRNA esiRNA human TNFSF11 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003701 Rosetta Predictions human pricing
NM_033012 Rosetta Predictions human pricing
NM_057149 Rosetta Predictions rat pricing
NM_011613 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003701 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00096084 predicted 844
2 SASI_Hs01_00096085 predicted 860
3 SASI_Hs01_00096086 predicted 939
4 SASI_Hs02_00336118 predicted 942
5 SASI_Hs01_00096087 predicted 808
6 SASI_Hs01_00096088 predicted 1357
7 SASI_Hs01_00096089 predicted 930
8 SASI_Hs01_00096090 predicted 858
9 SASI_Hs01_00096091 predicted 1042
10 SASI_Hs01_00096092 predicted 1246
11 SASI_Hs01_00096093 predicted 660
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033012 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00234181 predicted 555
2 SASI_Hs01_00234182 predicted 560
3 SASI_Hs01_00234183 predicted 639
4 SASI_Hs02_00360682 predicted 655
5 SASI_Hs01_00234184 predicted 512
6 SASI_Hs01_00234185 predicted 1066
7 SASI_Hs01_00234186 predicted 634
8 SASI_Hs01_00234187 predicted 568
9 SASI_Hs01_00234188 predicted 744
10 SASI_Hs01_00234189 predicted 950
11 SASI_Hs01_00234190 predicted 362
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_057149 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00057928 predicted 622
2 SASI_Rn01_00057930 predicted 335
3 SASI_Rn01_00057931 predicted 214
4 SASI_Rn01_00057932 predicted 372
5 SASI_Rn01_00057934 predicted 684
6 SASI_Rn01_00057935 predicted 575
7 SASI_Rn01_00057936 predicted 330
8 SASI_Rn01_00057937 predicted 344
9 SASI_Rn02_00267106 predicted 551
10 SASI_Rn02_00267107 predicted 346
11 SASI_Rn01_00057929 predicted 521
12 SASI_Rn01_00057933 predicted 546
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011613 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00165854 predicted 1133
2 SASI_Mm01_00165855 predicted 914
3 SASI_Mm01_00165856 predicted 796
4 SASI_Mm01_00165857 predicted 798
5 SASI_Mm01_00165858 predicted 1171
6 SASI_Mm01_00165859 predicted 639
7 SASI_Mm01_00165860 predicted 894
8 SASI_Mm01_00165861 predicted 529
9 SASI_Mm01_00165862 predicted 1166
10 SASI_Mm01_00165863 predicted 370
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_033012
TNFSF11 MISSION shRNA Bacterial Glycerol Stock
tumor necrosis factor (ligand) superfamily, member 11
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000368358    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033012.3-1022s21c1
Sequence:CCGGCTAATGGTGTACGTCACTAAACTCGAGTTTAGTGACGTACACCATTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000355653    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033012.3-1211s21c1
Sequence:CCGGCCGGATCAGGATGCAACATACCTCGAGGTATGTTGCATCCTGATCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003363    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033012.x-397s1c1
Sequence:CCGGCCCATAAAGTGAGTCTGTCCTCTCGAGAGGACAGACTCACTTTATGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003366    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033012.x-563s1c1
Sequence:CCGGGTATCTTCAACTAATGGTGTACTCGAGTACACCATTAGTTGAAGATACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003367    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033012.x-1504s1c1
Sequence:CCGGGCAGTATATTTCTTCGTTCTTCTCGAGAAGAACGAAGAAATATACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003364    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033012.x-285s1c1
Sequence:CCGGGCAGAGAAAGCGATGGTGGATCTCGAGATCCACCATCGCTTTCTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003365    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033012.x-719s1c1
Sequence:CCGGAGAGGAAATCAGCATCGAGGTCTCGAGACCTCGATGCTGATTTCCTCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_033012
TNFSF11 MISSION shRNA shRNA Plasmid DNA
tumor necrosis factor (ligand) superfamily, member 11
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000368358    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033012.3-1022s21c1
Sequence:CCGGCTAATGGTGTACGTCACTAAACTCGAGTTTAGTGACGTACACCATTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000355653    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033012.3-1211s21c1
Sequence:CCGGCCGGATCAGGATGCAACATACCTCGAGGTATGTTGCATCCTGATCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003363    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033012.x-397s1c1
Sequence:CCGGCCCATAAAGTGAGTCTGTCCTCTCGAGAGGACAGACTCACTTTATGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003366    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033012.x-563s1c1
Sequence:CCGGGTATCTTCAACTAATGGTGTACTCGAGTACACCATTAGTTGAAGATACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003367    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033012.x-1504s1c1
Sequence:CCGGGCAGTATATTTCTTCGTTCTTCTCGAGAAGAACGAAGAAATATACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003364    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033012.x-285s1c1
Sequence:CCGGGCAGAGAAAGCGATGGTGGATCTCGAGATCCACCATCGCTTTCTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003365    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033012.x-719s1c1
Sequence:CCGGAGAGGAAATCAGCATCGAGGTCTCGAGACCTCGATGCTGATTTCCTCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_033012
TNFSF11 MISSION shRNA Lentiviral Transduction Particles
tumor necrosis factor (ligand) superfamily, member 11
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000368358    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033012.3-1022s21c1
Sequence:CCGGCTAATGGTGTACGTCACTAAACTCGAGTTTAGTGACGTACACCATTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000355653    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033012.3-1211s21c1
Sequence:CCGGCCGGATCAGGATGCAACATACCTCGAGGTATGTTGCATCCTGATCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003363    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033012.x-397s1c1
Sequence:CCGGCCCATAAAGTGAGTCTGTCCTCTCGAGAGGACAGACTCACTTTATGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003366    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033012.x-563s1c1
Sequence:CCGGGTATCTTCAACTAATGGTGTACTCGAGTACACCATTAGTTGAAGATACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003367    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033012.x-1504s1c1
Sequence:CCGGGCAGTATATTTCTTCGTTCTTCTCGAGAAGAACGAAGAAATATACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003364    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033012.x-285s1c1
Sequence:CCGGGCAGAGAAAGCGATGGTGGATCTCGAGATCCACCATCGCTTTCTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003365    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033012.x-719s1c1
Sequence:CCGGAGAGGAAATCAGCATCGAGGTCTCGAGACCTCGATGCTGATTTCCTCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011613
TNFSF11 MISSION shRNA Bacterial Glycerol Stock
tumor necrosis factor (ligand) superfamily, member 11
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000362704    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011613.3-863s21c1
Sequence:CCGGCTGATGGTGTATGTCGTTAAACTCGAGTTTAACGACATACACCATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000362705    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011613.3-1484s21c1
Sequence:CCGGATGATAGTGTGAAGGGTTAAGCTCGAGCTTAACCCTTCACACTATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000362773    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011613.3-792s21c1
Sequence:CCGGATTACCTGTACGCCAACATTTCTCGAGAAATGTTGGCGTACAGGTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066283    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011613.2-1094s1c1
Sequence:CCGGGCTTTCAAAGTTCAGGACATACTCGAGTATGTCCTGAACTTTGAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066284    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011613.2-913s1c1
Sequence:CCGGCCCAAGTTCTCATAACCTGATCTCGAGATCAGGTTATGAGAACTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066286    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011613.2-760s1c1
Sequence:CCGGCATGACGTTAAGCAACGGAAACTCGAGTTTCCGTTGCTTAACGTCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066287    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011613.2-877s1c1
Sequence:CCGGGCTGATGGTGTATGTCGTTAACTCGAGTTAACGACATACACCATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066285    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011613.2-387s1c1
Sequence:CCGGCGCAGATGGATCCTAACAGAACTCGAGTTCTGTTAGGATCCATCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011613
TNFSF11 MISSION shRNA shRNA Plasmid DNA
tumor necrosis factor (ligand) superfamily, member 11
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000362704    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011613.3-863s21c1
Sequence:CCGGCTGATGGTGTATGTCGTTAAACTCGAGTTTAACGACATACACCATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000362705    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011613.3-1484s21c1
Sequence:CCGGATGATAGTGTGAAGGGTTAAGCTCGAGCTTAACCCTTCACACTATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000362773    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011613.3-792s21c1
Sequence:CCGGATTACCTGTACGCCAACATTTCTCGAGAAATGTTGGCGTACAGGTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066283    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011613.2-1094s1c1
Sequence:CCGGGCTTTCAAAGTTCAGGACATACTCGAGTATGTCCTGAACTTTGAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066284    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011613.2-913s1c1
Sequence:CCGGCCCAAGTTCTCATAACCTGATCTCGAGATCAGGTTATGAGAACTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066286    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011613.2-760s1c1
Sequence:CCGGCATGACGTTAAGCAACGGAAACTCGAGTTTCCGTTGCTTAACGTCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066287    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011613.2-877s1c1
Sequence:CCGGGCTGATGGTGTATGTCGTTAACTCGAGTTAACGACATACACCATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066285    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011613.2-387s1c1
Sequence:CCGGCGCAGATGGATCCTAACAGAACTCGAGTTCTGTTAGGATCCATCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011613
TNFSF11 MISSION shRNA Lentiviral Transduction Particles
tumor necrosis factor (ligand) superfamily, member 11
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000362704    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011613.3-863s21c1
Sequence:CCGGCTGATGGTGTATGTCGTTAAACTCGAGTTTAACGACATACACCATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000362705    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011613.3-1484s21c1
Sequence:CCGGATGATAGTGTGAAGGGTTAAGCTCGAGCTTAACCCTTCACACTATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000362773    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011613.3-792s21c1
Sequence:CCGGATTACCTGTACGCCAACATTTCTCGAGAAATGTTGGCGTACAGGTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066283    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011613.2-1094s1c1
Sequence:CCGGGCTTTCAAAGTTCAGGACATACTCGAGTATGTCCTGAACTTTGAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066284    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011613.2-913s1c1
Sequence:CCGGCCCAAGTTCTCATAACCTGATCTCGAGATCAGGTTATGAGAACTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066286    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011613.2-760s1c1
Sequence:CCGGCATGACGTTAAGCAACGGAAACTCGAGTTTCCGTTGCTTAACGTCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066287    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011613.2-877s1c1
Sequence:CCGGGCTGATGGTGTATGTCGTTAACTCGAGTTAACGACATACACCATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066285    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011613.2-387s1c1
Sequence:CCGGCGCAGATGGATCCTAACAGAACTCGAGTTCTGTTAGGATCCATCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks