EMAIL THIS PAGE TO A FRIEND

TNFSF12-TNFSF13

TNFSF12-TNFSF13 readthrough

Synonyms: TWE-PRIL
Gene ID:
Human(407977) Summary: This gene encodes a member of the tumor necrosis factor superfamily. It encodes a hybrid protein composed of the cytoplasmic and transmembrane domains of family member 12 fused to the C-terminal domain of family member 13. The hybrid protein is membrane anchored and presents the receptor-binding domain of family member 13 at the cell surface. It stimulates cycling in T- and B-lymphoma cell lines. [provided by RefSeq, Jul 2008]
34 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

ELISA

Product # Description Species Add to Cart
 
RAB1765 Human TWEAK R ELISA for serum, plasma and cell culture supernatants human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_172089 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_172089 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_172089 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU097141 MISSION® esiRNA esiRNA human TNFSF13 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_172089 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172089 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00053318 predicted 1494
2 SASI_Hs01_00053319 predicted 1487
3 SASI_Hs01_00053320 predicted 1536
4 SASI_Hs01_00053321 predicted 1491
5 SASI_Hs01_00053322 predicted 1489
6 SASI_Hs01_00053323 predicted 672
7 SASI_Hs01_00053324 predicted 909
8 SASI_Hs01_00053325 predicted 854
9 SASI_Hs02_00367807 predicted 1225
10 SASI_Hs01_00053327 predicted 793
11 SASI_Hs01_00053326 predicted 777
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172089
TNFSF12-TNFSF13 MISSION shRNA Bacterial Glycerol Stock
TNFSF12-TNFSF13 readthrough
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000204769    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_172089.2-1104s1c1
Sequence:CCGGGACAGCCAAGAGCTGAGTATACTCGAGTATACTCAGCTCTTGGCTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000204191    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172089.2-377s1c1
Sequence:CCGGGCAGCCCATTATGAAGTTCATCTCGAGATGAACTTCATAATGGGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000204239    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172089.2-990s1c1
Sequence:CCGGCAAGGGCGAAACTTAACCTCTCTCGAGAGAGGTTAAGTTTCGCCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000204329    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172089.2-934s1c1
Sequence:CCGGCGCAGGTGTCTTCCATTTACACTCGAGTGTAAATGGAAGACACCTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000188573    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172089.2-745s1c1
Sequence:CCGGCCAAGGATATGGTGTCCGAATCTCGAGATTCGGACACCATATCCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000186304    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_172089.2-1601s1c1
Sequence:CCGGCTTCGCAGTCAAATTACTCTTCTCGAGAAGAGTAATTTGACTGCGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172089
TNFSF12-TNFSF13 MISSION shRNA shRNA Plasmid DNA
TNFSF12-TNFSF13 readthrough
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000204769    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_172089.2-1104s1c1
Sequence:CCGGGACAGCCAAGAGCTGAGTATACTCGAGTATACTCAGCTCTTGGCTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000204191    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172089.2-377s1c1
Sequence:CCGGGCAGCCCATTATGAAGTTCATCTCGAGATGAACTTCATAATGGGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000204239    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172089.2-990s1c1
Sequence:CCGGCAAGGGCGAAACTTAACCTCTCTCGAGAGAGGTTAAGTTTCGCCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000204329    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172089.2-934s1c1
Sequence:CCGGCGCAGGTGTCTTCCATTTACACTCGAGTGTAAATGGAAGACACCTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000188573    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172089.2-745s1c1
Sequence:CCGGCCAAGGATATGGTGTCCGAATCTCGAGATTCGGACACCATATCCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000186304    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_172089.2-1601s1c1
Sequence:CCGGCTTCGCAGTCAAATTACTCTTCTCGAGAAGAGTAATTTGACTGCGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172089
TNFSF12-TNFSF13 MISSION shRNA Lentiviral Transduction Particles
TNFSF12-TNFSF13 readthrough
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000204769    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_172089.2-1104s1c1
Sequence:CCGGGACAGCCAAGAGCTGAGTATACTCGAGTATACTCAGCTCTTGGCTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000204191    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172089.2-377s1c1
Sequence:CCGGGCAGCCCATTATGAAGTTCATCTCGAGATGAACTTCATAATGGGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000204239    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172089.2-990s1c1
Sequence:CCGGCAAGGGCGAAACTTAACCTCTCTCGAGAGAGGTTAAGTTTCGCCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000204329    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172089.2-934s1c1
Sequence:CCGGCGCAGGTGTCTTCCATTTACACTCGAGTGTAAATGGAAGACACCTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000188573    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172089.2-745s1c1
Sequence:CCGGCCAAGGATATGGTGTCCGAATCTCGAGATTCGGACACCATATCCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000186304    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_172089.2-1601s1c1
Sequence:CCGGCTTCGCAGTCAAATTACTCTTCTCGAGAAGAGTAATTTGACTGCGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks