EMAIL THIS PAGE TO A FRIEND

TNFSF12

tumor necrosis factor (ligand) superfamily, member 12

Synonyms: APO3L DR3LG TWEAK
UniProtKB ID: O43508, Q8IZK7, Q8WUZ7
Gene ID:
Human(8742) Summary: The protein encoded by this gene is a cytokine that belongs to the tumor necrosis factor (TNF) ligand family. This protein is a ligand for the FN14/TWEAKR receptor. This cytokine has overlapping signaling functions with TNF, but displays a much wider tissue distribution. This cytokine, which exists in both membrane-bound and secreted forms, can induce apoptosis via multiple pathways of cell death in a cell type-specific manner. This cytokine is also found to promote proliferation and migration of endothelial cells, and thus acts as a regulator of angiogenesis. Alternative splicing results in multiple transcript variants. Some transcripts skip the last exon of this gene and continue into the second exon of the neighboring TNFSF13 gene; such read-through transcripts are contained in GeneID 407977, TNFSF12-TNFSF13. [provided by RefSeq, Oct 2010]
Mouse(21944) tumor necrosis factor (ligand) superfamily, member 12
Rat(360548) tumor necrosis factor ligand superfamily member 12
cow(100551513) tumor necrosis factor (ligand) superfamily, member 12
cow(100568284) tumor necrosis factor (ligand) superfamily, member 12
sheep(101122801) tumor necrosis factor (ligand) superfamily, member 12
domestic guinea pig(100713543) tumor necrosis factor (ligand) superfamily, member 12
Domestic Rabbit(100356651) tumor necrosis factor (ligand) superfamily, member 12
Zebrafish(567542) tumor necrosis factor (ligand) superfamily, member 12
dog(100568280) tumor necrosis factor (ligand) superfamily, member 12
Horse(100061872) tumor necrosis factor (ligand) superfamily, member 12
domestic cat(101098755) tumor necrosis factor (ligand) superfamily, member 12
Gene Class: Cytokines_and_Chemokines
144 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_153012 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_153012 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_153012 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011614 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011614 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011614 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_003809 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003809 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003809 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU227381 MISSION® esiRNA esiRNA targeting human TNFSF12 human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003809 Rosetta Predictions human pricing
NM_001001513 Rosetta Predictions rat pricing
XM_579057 Rosetta Predictions rat pricing
NM_011614 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003809 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00242950 predicted 335
2 SASI_Hs01_00242951 predicted 322
3 SASI_Hs01_00242952 predicted 333
4 SASI_Hs02_00336345 predicted 326
5 SASI_Hs01_00242953 predicted 350
6 SASI_Hs01_00242954 predicted 282
7 SASI_Hs01_00242955 predicted 337
8 SASI_Hs01_00242956 predicted 363
9 SASI_Hs01_00242957 predicted 326
10 SASI_Hs01_00242958 predicted 279
11 SASI_Hs01_00242959 predicted 354
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001001513 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00120375 predicted 762
2 SASI_Rn01_00120376 predicted 1053
3 SASI_Rn01_00120377 predicted 618
4 SASI_Rn01_00120379 predicted 601
5 SASI_Rn01_00120380 predicted 562
6 SASI_Rn01_00120381 predicted 1207
7 SASI_Rn02_00197912 predicted 598
8 SASI_Rn02_00197913 predicted 1207
9 SASI_Rn01_00120384 predicted 544
10 SASI_Rn02_00197914 predicted 562
11 SASI_Rn01_00120378 predicted 812
12 SASI_Rn01_00120382 predicted 1079
13 SASI_Rn01_00120383 predicted 533
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_579057 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00152334 predicted 370
2 SASI_Rn01_00152335 predicted 323
3 SASI_Rn01_00152336 predicted 318
4 SASI_Rn01_00152337 predicted 384
5 SASI_Rn01_00152338 predicted 311
6 SASI_Rn01_00152339 predicted 420
7 SASI_Rn01_00152340 predicted 391
8 SASI_Rn01_00152341 predicted 379
9 SASI_Rn01_00152342 predicted 307
10 SASI_Rn01_00152343 predicted 309
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011614 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00114511 predicted 612
2 SASI_Mm01_00114512 predicted 303
3 SASI_Mm01_00114513 predicted 906
4 SASI_Mm01_00114514 predicted 905
5 SASI_Mm02_00321046 predicted 387
6 SASI_Mm01_00114515 predicted 306
7 SASI_Mm01_00114516 predicted 1003
8 SASI_Mm01_00114517 predicted 378
9 SASI_Mm01_00114518 predicted 955
10 SASI_Mm01_00114519 predicted 253
11 SASI_Mm01_00114520 predicted 494
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153012
VALIDATED
TNFSF12 MISSION shRNA Bacterial Glycerol Stock
tumor necrosis factor (ligand) superfamily, member 12
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000058152    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_153012.1-460s1c1
Sequence:CCGGGCGCAGGCAGATGGAGGTTACCTCGAGGTAACCTCCATCTGCCTGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058148    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153012.1-467s1c1
Sequence:CCGGCAGATGGAGGTTACACAACTTCTCGAGAAGTTGTGTAACCTCCATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058150    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153012.1-343s1c1
Sequence:CCGGCCTTTCCTGAACCGACTAGTTCTCGAGAACTAGTCGGTTCAGGAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058151    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153012.1-316s1c1
Sequence:CCGGCAGACAGAAGAAAGCCAGGATCTCGAGATCCTGGCTTTCTTCTGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058149    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153012.1-418s1c1
Sequence:CCGGGCAGCCCATTATGAAGTTCATCTCGAGATGAACTTCATAATGGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153012
VALIDATED
TNFSF12 MISSION shRNA shRNA Plasmid DNA
tumor necrosis factor (ligand) superfamily, member 12
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000058152    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_153012.1-460s1c1
Sequence:CCGGGCGCAGGCAGATGGAGGTTACCTCGAGGTAACCTCCATCTGCCTGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058148    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153012.1-467s1c1
Sequence:CCGGCAGATGGAGGTTACACAACTTCTCGAGAAGTTGTGTAACCTCCATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058150    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153012.1-343s1c1
Sequence:CCGGCCTTTCCTGAACCGACTAGTTCTCGAGAACTAGTCGGTTCAGGAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058151    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153012.1-316s1c1
Sequence:CCGGCAGACAGAAGAAAGCCAGGATCTCGAGATCCTGGCTTTCTTCTGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058149    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153012.1-418s1c1
Sequence:CCGGGCAGCCCATTATGAAGTTCATCTCGAGATGAACTTCATAATGGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153012
VALIDATED
TNFSF12 MISSION shRNA Lentiviral Transduction Particles
tumor necrosis factor (ligand) superfamily, member 12
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000058152    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_153012.1-460s1c1
Sequence:CCGGGCGCAGGCAGATGGAGGTTACCTCGAGGTAACCTCCATCTGCCTGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058148    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153012.1-467s1c1
Sequence:CCGGCAGATGGAGGTTACACAACTTCTCGAGAAGTTGTGTAACCTCCATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058150    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153012.1-343s1c1
Sequence:CCGGCCTTTCCTGAACCGACTAGTTCTCGAGAACTAGTCGGTTCAGGAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058151    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153012.1-316s1c1
Sequence:CCGGCAGACAGAAGAAAGCCAGGATCTCGAGATCCTGGCTTTCTTCTGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058149    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153012.1-418s1c1
Sequence:CCGGGCAGCCCATTATGAAGTTCATCTCGAGATGAACTTCATAATGGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011614
TNFSF12 MISSION shRNA Bacterial Glycerol Stock
tumor necrosis factor (ligand) superfamily, member 12
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000066323    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011614.1-313s1c1
Sequence:CCGGCGAGCTATTGCAGCCCATTATCTCGAGATAATGGGCTGCAATAGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066325    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011614.1-271s1c1
Sequence:CCGGCCTCGAAGAAGTGCTCCTAAACTCGAGTTTAGGAGCACTTCTTCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066326    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011614.1-244s1c1
Sequence:CCGGGTACCTTTCTTGGAACAACTACTCGAGTAGTTGTTCCAAGAAAGGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066327    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011614.1-454s1c1
Sequence:CCGGGAATTTACAGTCATCAGGGCTCTCGAGAGCCCTGATGACTGTAAATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066324    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011614.1-717s1c1
Sequence:CCGGCCTAACCTACTTTGGACTCTTCTCGAGAAGAGTCCAAAGTAGGTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000362838    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011614.2-1251s21c1
Sequence:CCGGACTCACCCGACCACGTGTTTACTCGAGTAAACACGTGGTCGGGTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000362839    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011614.2-962s21c1
Sequence:CCGGTAACCTACTTTGGACTCTTTCCTCGAGGAAAGAGTCCAAAGTAGGTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000362908    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011614.2-1158s21c1
Sequence:CCGGACGTATCCTTGCTCTTCTTTACTCGAGTAAAGAAGAGCAAGGATACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011614
TNFSF12 MISSION shRNA shRNA Plasmid DNA
tumor necrosis factor (ligand) superfamily, member 12
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000066323    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011614.1-313s1c1
Sequence:CCGGCGAGCTATTGCAGCCCATTATCTCGAGATAATGGGCTGCAATAGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066325    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011614.1-271s1c1
Sequence:CCGGCCTCGAAGAAGTGCTCCTAAACTCGAGTTTAGGAGCACTTCTTCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066326    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011614.1-244s1c1
Sequence:CCGGGTACCTTTCTTGGAACAACTACTCGAGTAGTTGTTCCAAGAAAGGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066327    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011614.1-454s1c1
Sequence:CCGGGAATTTACAGTCATCAGGGCTCTCGAGAGCCCTGATGACTGTAAATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066324    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011614.1-717s1c1
Sequence:CCGGCCTAACCTACTTTGGACTCTTCTCGAGAAGAGTCCAAAGTAGGTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000362838    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011614.2-1251s21c1
Sequence:CCGGACTCACCCGACCACGTGTTTACTCGAGTAAACACGTGGTCGGGTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000362839    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011614.2-962s21c1
Sequence:CCGGTAACCTACTTTGGACTCTTTCCTCGAGGAAAGAGTCCAAAGTAGGTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000362908    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011614.2-1158s21c1
Sequence:CCGGACGTATCCTTGCTCTTCTTTACTCGAGTAAAGAAGAGCAAGGATACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011614
TNFSF12 MISSION shRNA Lentiviral Transduction Particles
tumor necrosis factor (ligand) superfamily, member 12
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000066323    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011614.1-313s1c1
Sequence:CCGGCGAGCTATTGCAGCCCATTATCTCGAGATAATGGGCTGCAATAGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066325    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011614.1-271s1c1
Sequence:CCGGCCTCGAAGAAGTGCTCCTAAACTCGAGTTTAGGAGCACTTCTTCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066326    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011614.1-244s1c1
Sequence:CCGGGTACCTTTCTTGGAACAACTACTCGAGTAGTTGTTCCAAGAAAGGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066327    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011614.1-454s1c1
Sequence:CCGGGAATTTACAGTCATCAGGGCTCTCGAGAGCCCTGATGACTGTAAATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066324    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011614.1-717s1c1
Sequence:CCGGCCTAACCTACTTTGGACTCTTCTCGAGAAGAGTCCAAAGTAGGTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000362838    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011614.2-1251s21c1
Sequence:CCGGACTCACCCGACCACGTGTTTACTCGAGTAAACACGTGGTCGGGTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000362839    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011614.2-962s21c1
Sequence:CCGGTAACCTACTTTGGACTCTTTCCTCGAGGAAAGAGTCCAAAGTAGGTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000362908    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011614.2-1158s21c1
Sequence:CCGGACGTATCCTTGCTCTTCTTTACTCGAGTAAAGAAGAGCAAGGATACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003809
VALIDATED
TNFSF12 MISSION shRNA Bacterial Glycerol Stock
tumor necrosis factor (ligand) superfamily, member 12
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000373710    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003809.2-1015s21c1
Sequence:CCGGGTATTCCCACTCTTATCTTACCTCGAGGTAAGATAAGAGTGGGAATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000373712    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_003809.2-1134s21c1
Sequence:CCGGGGGCATTGTGTTCACTGTACTCTCGAGAGTACAGTGAACACAATGCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000373713    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_003809.2-813s21c1
Sequence:CCGGCCTCACCTACTTCGGACTCTTCTCGAGAAGAGTCCGAAGTAGGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000373711    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_003809.2-583s21c1
Sequence:CCGGCTGTACTGTCAGGTGCACTTTCTCGAGAAAGTGCACCTGACAGTACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003809
VALIDATED
TNFSF12 MISSION shRNA shRNA Plasmid DNA
tumor necrosis factor (ligand) superfamily, member 12
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000373710    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003809.2-1015s21c1
Sequence:CCGGGTATTCCCACTCTTATCTTACCTCGAGGTAAGATAAGAGTGGGAATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000373712    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_003809.2-1134s21c1
Sequence:CCGGGGGCATTGTGTTCACTGTACTCTCGAGAGTACAGTGAACACAATGCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000373713    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_003809.2-813s21c1
Sequence:CCGGCCTCACCTACTTCGGACTCTTCTCGAGAAGAGTCCGAAGTAGGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000373711    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_003809.2-583s21c1
Sequence:CCGGCTGTACTGTCAGGTGCACTTTCTCGAGAAAGTGCACCTGACAGTACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003809
VALIDATED
TNFSF12 MISSION shRNA Lentiviral Transduction Particles
tumor necrosis factor (ligand) superfamily, member 12
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000373710    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003809.2-1015s21c1
Sequence:CCGGGTATTCCCACTCTTATCTTACCTCGAGGTAAGATAAGAGTGGGAATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000373712    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_003809.2-1134s21c1
Sequence:CCGGGGGCATTGTGTTCACTGTACTCTCGAGAGTACAGTGAACACAATGCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000373713    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_003809.2-813s21c1
Sequence:CCGGCCTCACCTACTTCGGACTCTTCTCGAGAAGAGTCCGAAGTAGGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000373711    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_003809.2-583s21c1
Sequence:CCGGCTGTACTGTCAGGTGCACTTTCTCGAGAAAGTGCACCTGACAGTACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks