EMAIL THIS PAGE TO A FRIEND

TNFSF13

tumor necrosis factor (ligand) superfamily, member 13

Synonyms: APRIL CD256 TALL-2 TALL2 TRDL-1 ZTNF2
Gene ID:
Human(8741) Summary: The protein encoded by this gene is a member of the tumor necrosis factor (TNF) ligand family. This protein is a ligand for TNFRSF17/BCMA, a member of the TNF receptor family. This protein and its receptor are both found to be important for B cell development. In vitro experiments suggested that this protein may be able to induce apoptosis through its interaction with other TNF receptor family proteins such as TNFRSF6/FAS and TNFRSF14/HVEM. Alternative splicing results in multiple transcript variants. Some transcripts that skip the last exon of the upstream gene (TNFSF12) and continue into the second exon of this gene have been identified; such read-through transcripts are contained in GeneID 407977, TNFSF12-TNFSF13. [provided by RefSeq, Oct 2010]
Mouse(69583) tumor necrosis factor (ligand) superfamily, member 13
Rat(287437) tumor necrosis factor (ligand) superfamily, member 13
Zebrafish(100149404) tumor necrosis factor (ligand) superfamily, member 13
domestic cat(100328582) tumor necrosis factor (ligand) superfamily, member 13
Horse(100147233) tumor necrosis factor (ligand) superfamily, member 13
dog(100568281) tumor necrosis factor (ligand) superfamily, member 13
Domestic Rabbit(100126074) tumor necrosis factor (ligand) superfamily, member 13
naked mole-rat(101726318) tumor necrosis factor (ligand) superfamily, member 13
cow(538567) tumor necrosis factor (ligand) superfamily, member 13
Goat(100860886) tumor necrosis factor (ligand) superfamily, member 13
sheep(101123054) tumor necrosis factor (ligand) superfamily, member 13
Gene Class: Cytokines_and_Chemokines
99 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_023517 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_023517 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_023517 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_003808 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003808 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003808 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003808 Rosetta Predictions human pricing
NM_172087 Rosetta Predictions human pricing
NM_172088 Rosetta Predictions human pricing
NM_001009623 Rosetta Predictions rat pricing
NM_023517 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003808 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00069082 predicted 1933
2 SASI_Hs01_00069083 predicted 1926
3 SASI_Hs01_00069084 predicted 1984
4 SASI_Hs01_00069085 predicted 1940
5 SASI_Hs01_00069086 predicted 1929
6 SASI_Hs02_00336343 predicted 1114
7 SASI_Hs01_00069087 predicted 1357
8 SASI_Hs01_00069088 predicted 1306
9 SASI_Hs01_00069089 predicted 1664
10 SASI_Hs02_00336344 predicted 1244
11 SASI_Hs01_00069090 predicted 1487
12 SASI_Hs01_00069091 predicted 809
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172087 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00144317 predicted 1892
2 SASI_Hs01_00144318 predicted 1881
3 SASI_Hs01_00144319 predicted 1940
4 SASI_Hs01_00144320 predicted 1888
5 SASI_Hs01_00144321 predicted 1886
6 SASI_Hs01_00144322 predicted 1309
7 SASI_Hs01_00144323 predicted 1252
8 SASI_Hs01_00144325 predicted 1620
9 SASI_Hs01_00144326 predicted 1191
10 SASI_Hs02_00367806 predicted 1428
11 SASI_Hs01_00144324 predicted 1172
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172088 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00177747 predicted 1812
2 SASI_Hs01_00177748 predicted 1756
3 SASI_Hs01_00177749 predicted 1857
4 SASI_Hs01_00177750 predicted 1747
5 SASI_Hs01_00177751 predicted 1858
6 SASI_Hs01_00177752 predicted 1800
7 SASI_Hs01_00177753 predicted 1855
8 SASI_Hs01_00177754 predicted 1851
9 SASI_Hs01_00177755 predicted 1760
10 SASI_Hs01_00177756 predicted 1755
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001009623 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00070976 predicted 977
2 SASI_Rn01_00070977 predicted 851
3 SASI_Rn01_00070978 predicted 1111
4 SASI_Rn01_00070979 predicted 1133
5 SASI_Rn01_00070980 predicted 580
6 SASI_Rn02_00199626 predicted 710
7 SASI_Rn01_00070983 predicted 1116
8 SASI_Rn01_00070985 predicted 365
9 SASI_Rn02_00199627 predicted 1049
10 SASI_Rn02_00199628 predicted 1046
11 SASI_Rn01_00070981 predicted 740
12 SASI_Rn01_00070982 predicted 804
13 SASI_Rn01_00070984 predicted 1031
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023517 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00188019 predicted 1402
2 SASI_Mm01_00188020 predicted 1358
3 SASI_Mm01_00188021 predicted 768
4 SASI_Mm01_00188022 predicted 663
5 SASI_Mm02_00327163 predicted 1066
6 SASI_Mm01_00188023 predicted 877
7 SASI_Mm01_00188024 predicted 1296
8 SASI_Mm01_00188025 predicted 843
9 SASI_Mm01_00188027 predicted 1157
10 SASI_Mm01_00188028 predicted 829
11 SASI_Mm01_00188026 predicted 1394
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_023517
TNFSF13 MISSION shRNA Bacterial Glycerol Stock
tumor necrosis factor (ligand) superfamily, member 13
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000076983    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023517.1-1334s1c1
Sequence:CCGGTGGCTAGACAAAGGACAAGGACTCGAGTCCTTGTCCTTTGTCTAGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076987    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023517.1-684s1c1
Sequence:CCGGGCACTACTGATCCAACAGACACTCGAGTGTCTGTTGGATCAGTAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076986    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023517.1-1021s1c1
Sequence:CCGGCTGGAATTTATCTGCTCTATACTCGAGTATAGAGCAGATAAATTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076984    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023517.1-628s1c1
Sequence:CCGGCGGTTGCTCTTTGGTTGAGTTCTCGAGAACTCAACCAAAGAGCAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076985    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023517.1-1182s1c1
Sequence:CCGGGCAGGTGTCTTTCATTTACATCTCGAGATGTAAATGAAAGACACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000362494    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023517.2-417s21c1
Sequence:CCGGTCCAACAGACAGAGCTGCAAACTCGAGTTTGCAGCTCTGTCTGTTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000362413    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023517.2-406s21c1
Sequence:CCGGCGCACTACTGATCCAACAGACCTCGAGGTCTGTTGGATCAGTAGTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000362495    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023517.2-394s21c1
Sequence:CCGGGACTTGTGCTGTCGCACTACTCTCGAGAGTAGTGCGACAGCACAAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_023517
TNFSF13 MISSION shRNA shRNA Plasmid DNA
tumor necrosis factor (ligand) superfamily, member 13
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000076983    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023517.1-1334s1c1
Sequence:CCGGTGGCTAGACAAAGGACAAGGACTCGAGTCCTTGTCCTTTGTCTAGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076987    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023517.1-684s1c1
Sequence:CCGGGCACTACTGATCCAACAGACACTCGAGTGTCTGTTGGATCAGTAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076986    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023517.1-1021s1c1
Sequence:CCGGCTGGAATTTATCTGCTCTATACTCGAGTATAGAGCAGATAAATTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076984    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023517.1-628s1c1
Sequence:CCGGCGGTTGCTCTTTGGTTGAGTTCTCGAGAACTCAACCAAAGAGCAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076985    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023517.1-1182s1c1
Sequence:CCGGGCAGGTGTCTTTCATTTACATCTCGAGATGTAAATGAAAGACACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000362494    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023517.2-417s21c1
Sequence:CCGGTCCAACAGACAGAGCTGCAAACTCGAGTTTGCAGCTCTGTCTGTTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000362413    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023517.2-406s21c1
Sequence:CCGGCGCACTACTGATCCAACAGACCTCGAGGTCTGTTGGATCAGTAGTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000362495    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023517.2-394s21c1
Sequence:CCGGGACTTGTGCTGTCGCACTACTCTCGAGAGTAGTGCGACAGCACAAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_023517
TNFSF13 MISSION shRNA Lentiviral Transduction Particles
tumor necrosis factor (ligand) superfamily, member 13
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000076983    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023517.1-1334s1c1
Sequence:CCGGTGGCTAGACAAAGGACAAGGACTCGAGTCCTTGTCCTTTGTCTAGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076987    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023517.1-684s1c1
Sequence:CCGGGCACTACTGATCCAACAGACACTCGAGTGTCTGTTGGATCAGTAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076986    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023517.1-1021s1c1
Sequence:CCGGCTGGAATTTATCTGCTCTATACTCGAGTATAGAGCAGATAAATTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076984    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023517.1-628s1c1
Sequence:CCGGCGGTTGCTCTTTGGTTGAGTTCTCGAGAACTCAACCAAAGAGCAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076985    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023517.1-1182s1c1
Sequence:CCGGGCAGGTGTCTTTCATTTACATCTCGAGATGTAAATGAAAGACACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000362494    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023517.2-417s21c1
Sequence:CCGGTCCAACAGACAGAGCTGCAAACTCGAGTTTGCAGCTCTGTCTGTTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000362413    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023517.2-406s21c1
Sequence:CCGGCGCACTACTGATCCAACAGACCTCGAGGTCTGTTGGATCAGTAGTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000362495    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023517.2-394s21c1
Sequence:CCGGGACTTGTGCTGTCGCACTACTCTCGAGAGTAGTGCGACAGCACAAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003808
TNFSF13 MISSION shRNA Bacterial Glycerol Stock
tumor necrosis factor (ligand) superfamily, member 13
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000059023    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003808.2-1312s1c1
Sequence:CCGGGAGACTCTATTCCGATGTATACTCGAGTATACATCGGAATAGAGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059027    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003808.2-1441s1c1
Sequence:CCGGGCGAAACTTAACCTCTCTCCACTCGAGTGGAGAGAGGTTAAGTTTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059024    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003808.2-1208s1c1
Sequence:CCGGGAATCCAGGATGCTGGAGTTTCTCGAGAAACTCCAGCATCCTGGATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059025    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003808.2-1248s1c1
Sequence:CCGGCCTGTTTCAAGACGTGACTTTCTCGAGAAAGTCACGTCTTGAAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059026    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003808.2-1380s1c1
Sequence:CCGGCGCAGGTGTCTTCCATTTACACTCGAGTGTAAATGGAAGACACCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000358632    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003808.3-831s21c1
Sequence:CCGGCAGTTGCCCTCTGGTTGAGTTCTCGAGAACTCAACCAGAGGGCAACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000358567    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003808.3-781s21c1
Sequence:CCGGCAAAGGGCCTCCAGGCAACATCTCGAGATGTTGCCTGGAGGCCCTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000358565    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003808.3-884s21c1
Sequence:CCGGATGGCTCTGCTGACCCAACAACTCGAGTTGTTGGGTCAGCAGAGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000358631    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003808.3-897s21c1
Sequence:CCGGCCCAACAAACAGAGCTGCAGACTCGAGTCTGCAGCTCTGTTTGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003808
TNFSF13 MISSION shRNA shRNA Plasmid DNA
tumor necrosis factor (ligand) superfamily, member 13
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000059023    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003808.2-1312s1c1
Sequence:CCGGGAGACTCTATTCCGATGTATACTCGAGTATACATCGGAATAGAGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059027    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003808.2-1441s1c1
Sequence:CCGGGCGAAACTTAACCTCTCTCCACTCGAGTGGAGAGAGGTTAAGTTTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059024    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003808.2-1208s1c1
Sequence:CCGGGAATCCAGGATGCTGGAGTTTCTCGAGAAACTCCAGCATCCTGGATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059025    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003808.2-1248s1c1
Sequence:CCGGCCTGTTTCAAGACGTGACTTTCTCGAGAAAGTCACGTCTTGAAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059026    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003808.2-1380s1c1
Sequence:CCGGCGCAGGTGTCTTCCATTTACACTCGAGTGTAAATGGAAGACACCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000358632    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003808.3-831s21c1
Sequence:CCGGCAGTTGCCCTCTGGTTGAGTTCTCGAGAACTCAACCAGAGGGCAACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000358567    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003808.3-781s21c1
Sequence:CCGGCAAAGGGCCTCCAGGCAACATCTCGAGATGTTGCCTGGAGGCCCTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000358565    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003808.3-884s21c1
Sequence:CCGGATGGCTCTGCTGACCCAACAACTCGAGTTGTTGGGTCAGCAGAGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000358631    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003808.3-897s21c1
Sequence:CCGGCCCAACAAACAGAGCTGCAGACTCGAGTCTGCAGCTCTGTTTGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003808
TNFSF13 MISSION shRNA Lentiviral Transduction Particles
tumor necrosis factor (ligand) superfamily, member 13
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000059023    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003808.2-1312s1c1
Sequence:CCGGGAGACTCTATTCCGATGTATACTCGAGTATACATCGGAATAGAGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059027    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003808.2-1441s1c1
Sequence:CCGGGCGAAACTTAACCTCTCTCCACTCGAGTGGAGAGAGGTTAAGTTTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059024    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003808.2-1208s1c1
Sequence:CCGGGAATCCAGGATGCTGGAGTTTCTCGAGAAACTCCAGCATCCTGGATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059025    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003808.2-1248s1c1
Sequence:CCGGCCTGTTTCAAGACGTGACTTTCTCGAGAAAGTCACGTCTTGAAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059026    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003808.2-1380s1c1
Sequence:CCGGCGCAGGTGTCTTCCATTTACACTCGAGTGTAAATGGAAGACACCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000358632    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003808.3-831s21c1
Sequence:CCGGCAGTTGCCCTCTGGTTGAGTTCTCGAGAACTCAACCAGAGGGCAACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000358567    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003808.3-781s21c1
Sequence:CCGGCAAAGGGCCTCCAGGCAACATCTCGAGATGTTGCCTGGAGGCCCTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000358565    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003808.3-884s21c1
Sequence:CCGGATGGCTCTGCTGACCCAACAACTCGAGTTGTTGGGTCAGCAGAGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000358631    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003808.3-897s21c1
Sequence:CCGGCCCAACAAACAGAGCTGCAGACTCGAGTCTGCAGCTCTGTTTGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks